Incidental Mutation 'R5656:Klhl41'
ID 442302
Institutional Source Beutler Lab
Gene Symbol Klhl41
Ensembl Gene ENSMUSG00000075307
Gene Name kelch-like 41
Synonyms Kbtbd10, LOC228003
MMRRC Submission 043302-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R5656 (G1)
Quality Score 164
Status Not validated
Chromosome 2
Chromosomal Location 69500464-69514574 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 69513876 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 585 (I585N)
Ref Sequence ENSEMBL: ENSMUSP00000097627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073152] [ENSMUST00000100050] [ENSMUST00000102706]
AlphaFold A2AUC9
Predicted Effect probably benign
Transcript: ENSMUST00000073152
SMART Domains Protein: ENSMUSP00000072896
Gene: ENSMUSG00000027086

DomainStartEndE-ValueType
low complexity region 179 191 N/A INTRINSIC
low complexity region 316 324 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
Pfam:FAST_1 560 628 6.6e-25 PFAM
Pfam:FAST_2 645 730 6.4e-26 PFAM
RAP 763 822 4.38e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100050
AA Change: I585N

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097627
Gene: ENSMUSG00000075307
AA Change: I585N

DomainStartEndE-ValueType
BTB 33 130 8.34e-27 SMART
BACK 135 237 9.67e-36 SMART
Kelch 346 398 6.71e-1 SMART
Kelch 399 447 1.56e-5 SMART
Kelch 448 495 2.43e-7 SMART
Kelch 496 542 5.81e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102706
SMART Domains Protein: ENSMUSP00000099767
Gene: ENSMUSG00000027086

DomainStartEndE-ValueType
low complexity region 179 191 N/A INTRINSIC
low complexity region 316 324 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
Pfam:FAST_1 530 600 2.2e-26 PFAM
Pfam:FAST_2 614 701 4.4e-31 PFAM
RAP 734 793 4.38e-25 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the kelch-like family. The encoded protein contains a BACK domain, a BTB/POZ domain, and 5 Kelch repeats. This protein is thought to function in skeletal muscle development and maintenance. Mutations in this gene have been associated with nemaline myopathy (NM), a rare congenital muscle disorder. [provided by RefSeq, Mar 2015]
PHENOTYPE: The gene product is involved in stabilizing proteins involved in muscle function. Homozygous knockout affects the structure of muscle fibers and their sarcomeres, resulting in neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 106,436,144 (GRCm39) S139G probably benign Het
Adrb3 T C 8: 27,717,405 (GRCm39) D348G probably damaging Het
Atg2b A G 12: 105,587,587 (GRCm39) V1959A probably benign Het
Bicral G A 17: 47,119,295 (GRCm39) T742M probably damaging Het
Bub1b T A 2: 118,435,912 (GRCm39) I60N probably damaging Het
Ccdc162 A G 10: 41,445,930 (GRCm39) V414A probably benign Het
Cd22 T G 7: 30,569,198 (GRCm39) Y612S probably damaging Het
Cd68 T A 11: 69,555,247 (GRCm39) I320F probably damaging Het
Clca3a2 A T 3: 144,503,393 (GRCm39) N852K probably benign Het
Cpa6 T A 1: 10,399,739 (GRCm39) H363L probably benign Het
Ddx18 A T 1: 121,489,087 (GRCm39) L320Q probably damaging Het
Dnah5 A G 15: 28,421,210 (GRCm39) D3849G probably benign Het
Eci1 T A 17: 24,656,283 (GRCm39) N164K probably damaging Het
Efs T C 14: 55,154,584 (GRCm39) T552A probably damaging Het
Fbp1 C A 13: 63,023,010 (GRCm39) V96L probably damaging Het
Gtf3c1 T A 7: 125,261,826 (GRCm39) N1139I probably benign Het
Gucy1b2 T C 14: 62,660,430 (GRCm39) Y152C probably damaging Het
Gxylt1 A T 15: 93,143,542 (GRCm39) L362Q probably damaging Het
Iqcd A G 5: 120,743,191 (GRCm39) probably null Het
Map6 A G 7: 98,985,505 (GRCm39) K470E probably damaging Het
Mast3 T C 8: 71,238,865 (GRCm39) T496A probably damaging Het
Mbd6 A T 10: 127,121,155 (GRCm39) probably benign Het
Melk A G 4: 44,312,237 (GRCm39) K183R possibly damaging Het
Mta1 T C 12: 113,086,759 (GRCm39) V152A probably damaging Het
Naa35 G A 13: 59,770,680 (GRCm39) probably benign Het
Nav3 A C 10: 109,600,494 (GRCm39) S1378A probably damaging Het
Ncapd3 T A 9: 26,962,941 (GRCm39) D415E possibly damaging Het
Nlrp4f G A 13: 65,338,685 (GRCm39) R651* probably null Het
Or1e1f T A 11: 73,855,536 (GRCm39) M34K probably damaging Het
Or5b121 A G 19: 13,507,744 (GRCm39) T280A probably benign Het
Or5p72 A G 7: 108,021,825 (GRCm39) I16V probably benign Het
P2rx7 A T 5: 122,811,780 (GRCm39) R364W probably damaging Het
Phactr2 T C 10: 13,264,447 (GRCm39) D2G probably benign Het
Phc3 G T 3: 31,020,015 (GRCm39) S28R probably damaging Het
Ppfia1 A T 7: 144,073,711 (GRCm39) probably null Het
Prdm10 C T 9: 31,264,713 (GRCm39) T667M probably benign Het
Pwwp2b T A 7: 138,835,887 (GRCm39) S443T possibly damaging Het
Pzp T C 6: 128,467,035 (GRCm39) T1113A probably damaging Het
Rapgef6 A G 11: 54,526,962 (GRCm39) E551G possibly damaging Het
Sec23ip A G 7: 128,378,508 (GRCm39) Y774C probably damaging Het
Setdb2 T C 14: 59,656,567 (GRCm39) D266G probably damaging Het
Shank1 T C 7: 44,002,310 (GRCm39) V1343A probably benign Het
Slf2 T A 19: 44,961,674 (GRCm39) D1064E probably benign Het
Slu7 A G 11: 43,334,245 (GRCm39) K424E probably benign Het
Smg1 A T 7: 117,753,887 (GRCm39) probably benign Het
Sptlc2 A T 12: 87,393,535 (GRCm39) L264Q probably damaging Het
Sra1 A G 18: 36,811,460 (GRCm39) S93P probably damaging Het
Sult1c2 T C 17: 54,271,680 (GRCm39) E169G probably benign Het
Sv2a A G 3: 96,092,888 (GRCm39) D196G probably damaging Het
Tbc1d22b A G 17: 29,813,754 (GRCm39) I362M probably damaging Het
Tenm3 T C 8: 48,681,797 (GRCm39) D2611G probably damaging Het
Tmem43 T C 6: 91,457,690 (GRCm39) F191L probably benign Het
Trbv13-2 T A 6: 41,098,628 (GRCm39) Y68N probably benign Het
Ttn T G 2: 76,604,998 (GRCm39) D18312A possibly damaging Het
Ublcp1 A G 11: 44,356,433 (GRCm39) V95A probably damaging Het
Usp17ld A G 7: 102,900,047 (GRCm39) V295A probably damaging Het
Vmn1r29 T A 6: 58,285,152 (GRCm39) L291M possibly damaging Het
Vsig10l C T 7: 43,113,575 (GRCm39) R176* probably null Het
Zbtb46 A G 2: 181,065,210 (GRCm39) probably null Het
Zfp644 A G 5: 106,785,848 (GRCm39) V233A probably benign Het
Other mutations in Klhl41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Klhl41 APN 2 69,505,068 (GRCm39) missense probably benign 0.00
IGL01622:Klhl41 APN 2 69,508,582 (GRCm39) missense probably benign 0.05
IGL01623:Klhl41 APN 2 69,508,582 (GRCm39) missense probably benign 0.05
IGL03237:Klhl41 APN 2 69,500,902 (GRCm39) missense possibly damaging 0.94
R0220:Klhl41 UTSW 2 69,500,829 (GRCm39) missense probably benign 0.25
R0277:Klhl41 UTSW 2 69,501,640 (GRCm39) missense probably damaging 1.00
R0456:Klhl41 UTSW 2 69,500,893 (GRCm39) missense probably damaging 0.99
R0485:Klhl41 UTSW 2 69,501,600 (GRCm39) missense probably damaging 0.97
R0536:Klhl41 UTSW 2 69,500,554 (GRCm39) missense probably benign 0.04
R0537:Klhl41 UTSW 2 69,500,554 (GRCm39) missense probably benign 0.04
R0552:Klhl41 UTSW 2 69,500,554 (GRCm39) missense probably benign 0.04
R0553:Klhl41 UTSW 2 69,500,554 (GRCm39) missense probably benign 0.04
R0834:Klhl41 UTSW 2 69,508,491 (GRCm39) missense possibly damaging 0.76
R0879:Klhl41 UTSW 2 69,513,827 (GRCm39) unclassified probably benign
R1531:Klhl41 UTSW 2 69,501,084 (GRCm39) missense probably benign 0.03
R1678:Klhl41 UTSW 2 69,501,283 (GRCm39) missense probably benign 0.01
R1792:Klhl41 UTSW 2 69,501,146 (GRCm39) missense probably benign 0.01
R1900:Klhl41 UTSW 2 69,504,963 (GRCm39) splice site probably benign
R2012:Klhl41 UTSW 2 69,513,840 (GRCm39) missense possibly damaging 0.61
R4041:Klhl41 UTSW 2 69,501,054 (GRCm39) missense probably benign 0.00
R5223:Klhl41 UTSW 2 69,510,171 (GRCm39) nonsense probably null
R5500:Klhl41 UTSW 2 69,513,873 (GRCm39) missense probably damaging 1.00
R5643:Klhl41 UTSW 2 69,500,815 (GRCm39) missense probably damaging 1.00
R5644:Klhl41 UTSW 2 69,500,815 (GRCm39) missense probably damaging 1.00
R6264:Klhl41 UTSW 2 69,510,176 (GRCm39) critical splice donor site probably null
R6678:Klhl41 UTSW 2 69,501,188 (GRCm39) missense probably benign 0.04
R6731:Klhl41 UTSW 2 69,505,044 (GRCm39) missense probably damaging 1.00
R7586:Klhl41 UTSW 2 69,505,068 (GRCm39) missense probably benign 0.33
R7664:Klhl41 UTSW 2 69,501,061 (GRCm39) missense probably damaging 1.00
R8158:Klhl41 UTSW 2 69,501,505 (GRCm39) missense probably damaging 1.00
R8341:Klhl41 UTSW 2 69,500,868 (GRCm39) missense probably benign 0.07
X0021:Klhl41 UTSW 2 69,510,050 (GRCm39) missense probably damaging 1.00
Z1088:Klhl41 UTSW 2 69,505,074 (GRCm39) missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CAGGCACTTTGTCTGGGTAG -3'
(R):5'- CTGCGTGAATCCCTGTAACC -3'

Sequencing Primer
(F):5'- CACTTTGTCTGGGTAGGAAGC -3'
(R):5'- GAATCCCTGTAACCCTATGTGAATC -3'
Posted On 2016-11-09