Incidental Mutation 'R5656:Sv2a'
ID442307
Institutional Source Beutler Lab
Gene Symbol Sv2a
Ensembl Gene ENSMUSG00000038486
Gene Namesynaptic vesicle glycoprotein 2 a
Synonyms
MMRRC Submission 043302-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5656 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location96181151-96195521 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96185572 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 196 (D196G)
Ref Sequence ENSEMBL: ENSMUSP00000037576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035371]
Predicted Effect probably damaging
Transcript: ENSMUST00000035371
AA Change: D196G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037576
Gene: ENSMUSG00000038486
AA Change: D196G

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
low complexity region 123 138 N/A INTRINSIC
Pfam:Sugar_tr 149 484 5.3e-30 PFAM
Pfam:MFS_1 168 483 1.6e-24 PFAM
Pfam:Pentapeptide_4 513 585 7.7e-11 PFAM
Pfam:MFS_1 561 739 3.9e-12 PFAM
Pfam:Sugar_tr 588 742 4.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133665
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of three related synaptic vesicle proteins. The encoded protein may interact with synaptotagmin to enhance low frequency neurotransmission in quiescent neurons. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit seizures, retarded growth, and reduced hippocampal (GABA)ergic neurotransmission. Many mutants die shortly after birth, and all are dead by three weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Adrb3 T C 8: 27,227,377 D348G probably damaging Het
Atg2b A G 12: 105,621,328 V1959A probably benign Het
Bicral G A 17: 46,808,369 T742M probably damaging Het
Bub1b T A 2: 118,605,431 I60N probably damaging Het
Ccdc162 A G 10: 41,569,934 V414A probably benign Het
Cd22 T G 7: 30,869,773 Y612S probably damaging Het
Cd68 T A 11: 69,664,421 I320F probably damaging Het
Clca3a2 A T 3: 144,797,632 N852K probably benign Het
Cpa6 T A 1: 10,329,514 H363L probably benign Het
Ddx18 A T 1: 121,561,358 L320Q probably damaging Het
Dnah5 A G 15: 28,421,064 D3849G probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Efs T C 14: 54,917,127 T552A probably damaging Het
Fbp1 C A 13: 62,875,196 V96L probably damaging Het
Gtf3c1 T A 7: 125,662,654 N1139I probably benign Het
Gucy1b2 T C 14: 62,422,981 Y152C probably damaging Het
Gxylt1 A T 15: 93,245,661 L362Q probably damaging Het
Iqcd A G 5: 120,605,126 probably null Het
Klhl41 T A 2: 69,683,532 I585N possibly damaging Het
Map6 A G 7: 99,336,298 K470E probably damaging Het
Mast3 T C 8: 70,786,221 T496A probably damaging Het
Mbd6 A T 10: 127,285,286 probably benign Het
Melk A G 4: 44,312,237 K183R possibly damaging Het
Mta1 T C 12: 113,123,139 V152A probably damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Nav3 A C 10: 109,764,633 S1378A probably damaging Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Nlrp4f G A 13: 65,190,871 R651* probably null Het
Olfr1480 A G 19: 13,530,380 T280A probably benign Het
Olfr397 T A 11: 73,964,710 M34K probably damaging Het
Olfr497 A G 7: 108,422,618 I16V probably benign Het
P2rx7 A T 5: 122,673,717 R364W probably damaging Het
Phactr2 T C 10: 13,388,703 D2G probably benign Het
Phc3 G T 3: 30,965,866 S28R probably damaging Het
Ppfia1 A T 7: 144,519,974 probably null Het
Prdm10 C T 9: 31,353,417 T667M probably benign Het
Pwwp2b T A 7: 139,255,971 S443T possibly damaging Het
Pzp T C 6: 128,490,072 T1113A probably damaging Het
Rapgef6 A G 11: 54,636,136 E551G possibly damaging Het
Sec23ip A G 7: 128,776,784 Y774C probably damaging Het
Setdb2 T C 14: 59,419,118 D266G probably damaging Het
Shank1 T C 7: 44,352,886 V1343A probably benign Het
Slf2 T A 19: 44,973,235 D1064E probably benign Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Smg1 A T 7: 118,154,664 probably benign Het
Sptlc2 A T 12: 87,346,761 L264Q probably damaging Het
Sra1 A G 18: 36,678,407 S93P probably damaging Het
Sult1c1 T C 17: 53,964,652 E169G probably benign Het
Tbc1d22b A G 17: 29,594,780 I362M probably damaging Het
Tenm3 T C 8: 48,228,762 D2611G probably damaging Het
Tmem43 T C 6: 91,480,708 F191L probably benign Het
Trbv13-2 T A 6: 41,121,694 Y68N probably benign Het
Ttn T G 2: 76,774,654 D18312A possibly damaging Het
Ublcp1 A G 11: 44,465,606 V95A probably damaging Het
Usp17ld A G 7: 103,250,840 V295A probably damaging Het
Vmn1r29 T A 6: 58,308,167 L291M possibly damaging Het
Vsig10l C T 7: 43,464,151 R176* probably null Het
Zbtb46 A G 2: 181,423,417 probably null Het
Zfp644 A G 5: 106,637,982 V233A probably benign Het
Other mutations in Sv2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Sv2a APN 3 96193284 missense probably benign 0.00
IGL01081:Sv2a APN 3 96189696 missense probably benign 0.35
IGL01786:Sv2a APN 3 96188209 missense probably benign 0.08
IGL02220:Sv2a APN 3 96190716 missense probably benign 0.13
IGL02701:Sv2a APN 3 96187131 missense probably damaging 0.99
IGL02740:Sv2a APN 3 96185407 missense possibly damaging 0.92
IGL03067:Sv2a APN 3 96185182 missense probably damaging 1.00
R0760:Sv2a UTSW 3 96188182 missense probably damaging 1.00
R2070:Sv2a UTSW 3 96193875 missense possibly damaging 0.95
R2071:Sv2a UTSW 3 96193875 missense possibly damaging 0.95
R2902:Sv2a UTSW 3 96193756 missense possibly damaging 0.84
R3014:Sv2a UTSW 3 96189435 nonsense probably null
R3153:Sv2a UTSW 3 96185258 missense possibly damaging 0.75
R4472:Sv2a UTSW 3 96192494 missense probably benign 0.36
R4653:Sv2a UTSW 3 96190762 critical splice donor site probably null
R4791:Sv2a UTSW 3 96192558 missense possibly damaging 0.68
R4844:Sv2a UTSW 3 96188379 missense probably damaging 1.00
R4919:Sv2a UTSW 3 96190755 missense probably benign 0.44
R5230:Sv2a UTSW 3 96185460 missense probably damaging 1.00
R5305:Sv2a UTSW 3 96185458 missense possibly damaging 0.83
R5659:Sv2a UTSW 3 96190303 missense possibly damaging 0.96
R5722:Sv2a UTSW 3 96185023 missense probably benign 0.01
R6299:Sv2a UTSW 3 96188249 critical splice donor site probably null
R6315:Sv2a UTSW 3 96188186 missense probably benign 0.06
R7192:Sv2a UTSW 3 96193746 missense probably damaging 1.00
R7374:Sv2a UTSW 3 96188209 missense probably benign 0.08
R7691:Sv2a UTSW 3 96188411 missense probably benign 0.00
X0026:Sv2a UTSW 3 96189452 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGAGAATATCAGGGCATCC -3'
(R):5'- TTACCCAGCCTCCAGAAGAG -3'

Sequencing Primer
(F):5'- CATGGCAGATGGGGCAC -3'
(R):5'- CTCCAGAAGAGGATGTCTACG -3'
Posted On2016-11-09