Incidental Mutation 'R5656:Melk'
ID442309
Institutional Source Beutler Lab
Gene Symbol Melk
Ensembl Gene ENSMUSG00000035683
Gene Namematernal embryonic leucine zipper kinase
SynonymsMPK38
MMRRC Submission 043302-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5656 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location44300876-44364675 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44312237 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 183 (K183R)
Ref Sequence ENSEMBL: ENSMUSP00000043806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045607] [ENSMUST00000125708] [ENSMUST00000137703]
PDB Structure
The crystal structure of mouse PK38 [X-RAY DIFFRACTION]
The crystal structure of MPK38 in complex with OTSSP167, an orally- administrative MELK selective inhibitor [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045607
AA Change: K183R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043806
Gene: ENSMUSG00000035683
AA Change: K183R

DomainStartEndE-ValueType
S_TKc 11 263 2.64e-105 SMART
low complexity region 313 325 N/A INTRINSIC
Pfam:KA1 599 643 2.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118668
Predicted Effect possibly damaging
Transcript: ENSMUST00000125708
AA Change: K112R

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118359
Gene: ENSMUSG00000035683
AA Change: K112R

DomainStartEndE-ValueType
Pfam:Pkinase 11 91 1.9e-15 PFAM
Pfam:Pkinase_Tyr 11 97 4.3e-10 PFAM
Pfam:Pkinase 88 134 6.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137703
AA Change: K135R

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000120242
Gene: ENSMUSG00000035683
AA Change: K135R

DomainStartEndE-ValueType
Pfam:Pkinase 11 88 7.7e-15 PFAM
Pfam:Pkinase_Tyr 11 88 3.1e-9 PFAM
Pfam:Pkinase_Tyr 87 212 1.5e-15 PFAM
Pfam:Pkinase 87 215 3.4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137759
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an allele that produces a kinase-dead protein exhibit altered pancreatic regeneration following injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Adrb3 T C 8: 27,227,377 D348G probably damaging Het
Atg2b A G 12: 105,621,328 V1959A probably benign Het
Bicral G A 17: 46,808,369 T742M probably damaging Het
Bub1b T A 2: 118,605,431 I60N probably damaging Het
Ccdc162 A G 10: 41,569,934 V414A probably benign Het
Cd22 T G 7: 30,869,773 Y612S probably damaging Het
Cd68 T A 11: 69,664,421 I320F probably damaging Het
Clca3a2 A T 3: 144,797,632 N852K probably benign Het
Cpa6 T A 1: 10,329,514 H363L probably benign Het
Ddx18 A T 1: 121,561,358 L320Q probably damaging Het
Dnah5 A G 15: 28,421,064 D3849G probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Efs T C 14: 54,917,127 T552A probably damaging Het
Fbp1 C A 13: 62,875,196 V96L probably damaging Het
Gtf3c1 T A 7: 125,662,654 N1139I probably benign Het
Gucy1b2 T C 14: 62,422,981 Y152C probably damaging Het
Gxylt1 A T 15: 93,245,661 L362Q probably damaging Het
Iqcd A G 5: 120,605,126 probably null Het
Klhl41 T A 2: 69,683,532 I585N possibly damaging Het
Map6 A G 7: 99,336,298 K470E probably damaging Het
Mast3 T C 8: 70,786,221 T496A probably damaging Het
Mbd6 A T 10: 127,285,286 probably benign Het
Mta1 T C 12: 113,123,139 V152A probably damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Nav3 A C 10: 109,764,633 S1378A probably damaging Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Nlrp4f G A 13: 65,190,871 R651* probably null Het
Olfr1480 A G 19: 13,530,380 T280A probably benign Het
Olfr397 T A 11: 73,964,710 M34K probably damaging Het
Olfr497 A G 7: 108,422,618 I16V probably benign Het
P2rx7 A T 5: 122,673,717 R364W probably damaging Het
Phactr2 T C 10: 13,388,703 D2G probably benign Het
Phc3 G T 3: 30,965,866 S28R probably damaging Het
Ppfia1 A T 7: 144,519,974 probably null Het
Prdm10 C T 9: 31,353,417 T667M probably benign Het
Pwwp2b T A 7: 139,255,971 S443T possibly damaging Het
Pzp T C 6: 128,490,072 T1113A probably damaging Het
Rapgef6 A G 11: 54,636,136 E551G possibly damaging Het
Sec23ip A G 7: 128,776,784 Y774C probably damaging Het
Setdb2 T C 14: 59,419,118 D266G probably damaging Het
Shank1 T C 7: 44,352,886 V1343A probably benign Het
Slf2 T A 19: 44,973,235 D1064E probably benign Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Smg1 A T 7: 118,154,664 probably benign Het
Sptlc2 A T 12: 87,346,761 L264Q probably damaging Het
Sra1 A G 18: 36,678,407 S93P probably damaging Het
Sult1c1 T C 17: 53,964,652 E169G probably benign Het
Sv2a A G 3: 96,185,572 D196G probably damaging Het
Tbc1d22b A G 17: 29,594,780 I362M probably damaging Het
Tenm3 T C 8: 48,228,762 D2611G probably damaging Het
Tmem43 T C 6: 91,480,708 F191L probably benign Het
Trbv13-2 T A 6: 41,121,694 Y68N probably benign Het
Ttn T G 2: 76,774,654 D18312A possibly damaging Het
Ublcp1 A G 11: 44,465,606 V95A probably damaging Het
Usp17ld A G 7: 103,250,840 V295A probably damaging Het
Vmn1r29 T A 6: 58,308,167 L291M possibly damaging Het
Vsig10l C T 7: 43,464,151 R176* probably null Het
Zbtb46 A G 2: 181,423,417 probably null Het
Zfp644 A G 5: 106,637,982 V233A probably benign Het
Other mutations in Melk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Melk APN 4 44347262 missense probably benign 0.05
IGL01367:Melk APN 4 44332907 missense possibly damaging 0.62
IGL01865:Melk APN 4 44344988 missense probably benign 0.00
IGL02801:Melk APN 4 44360930 missense probably damaging 0.99
R0037:Melk UTSW 4 44360864 splice site probably benign
R0433:Melk UTSW 4 44340614 splice site probably benign
R0570:Melk UTSW 4 44308906 missense probably damaging 1.00
R0786:Melk UTSW 4 44303649 missense unknown
R1483:Melk UTSW 4 44308937 missense probably damaging 1.00
R2042:Melk UTSW 4 44309051 critical splice donor site probably null
R3831:Melk UTSW 4 44345021 missense probably benign 0.05
R5060:Melk UTSW 4 44350959 missense probably benign 0.15
R5236:Melk UTSW 4 44344959 missense probably benign
R5269:Melk UTSW 4 44363730 missense probably damaging 1.00
R5357:Melk UTSW 4 44363730 missense probably damaging 1.00
R5358:Melk UTSW 4 44363730 missense probably damaging 1.00
R5360:Melk UTSW 4 44363730 missense probably damaging 1.00
R5430:Melk UTSW 4 44309033 missense probably damaging 1.00
R5576:Melk UTSW 4 44312255 missense probably null 1.00
R5738:Melk UTSW 4 44310333 missense probably damaging 1.00
R5972:Melk UTSW 4 44351007 missense probably benign 0.01
R6265:Melk UTSW 4 44318109 missense probably damaging 1.00
R6340:Melk UTSW 4 44340633 missense probably damaging 1.00
R7202:Melk UTSW 4 44351106 missense probably benign
R7242:Melk UTSW 4 44360885 missense probably damaging 1.00
R7328:Melk UTSW 4 44332931 missense probably benign
R7608:Melk UTSW 4 44325571 splice site probably null
R8053:Melk UTSW 4 44318109 missense probably damaging 1.00
R8185:Melk UTSW 4 44360965 missense probably benign 0.14
R8356:Melk UTSW 4 44312191 missense possibly damaging 0.75
R8456:Melk UTSW 4 44312191 missense possibly damaging 0.75
X0020:Melk UTSW 4 44349876 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GGCAGAATTCCTCACTTTGGGG -3'
(R):5'- TGACTGAACTAAGACACAAGTGC -3'

Sequencing Primer
(F):5'- GGCTGAGTCTGACCTTGAACTC -3'
(R):5'- TTTAATCCCAGCACTCAGGAGG -3'
Posted On2016-11-09