Incidental Mutation 'R5656:P2rx7'
ID 442312
Institutional Source Beutler Lab
Gene Symbol P2rx7
Ensembl Gene ENSMUSG00000029468
Gene Name purinergic receptor P2X, ligand-gated ion channel, 7
Synonyms P2X(7), P2X7R, P2X7 receptor
MMRRC Submission 043302-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5656 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 122781974-122829495 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 122811780 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 364 (R364W)
Ref Sequence ENSEMBL: ENSMUSP00000112440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031425] [ENSMUST00000100737] [ENSMUST00000121489]
AlphaFold Q9Z1M0
Predicted Effect probably damaging
Transcript: ENSMUST00000031425
AA Change: R364W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031425
Gene: ENSMUSG00000029468
AA Change: R364W

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 403 1e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100737
AA Change: R364W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098303
Gene: ENSMUSG00000029468
AA Change: R364W

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 397 3.6e-158 PFAM
low complexity region 435 451 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121489
AA Change: R364W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112440
Gene: ENSMUSG00000029468
AA Change: R364W

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 403 3.5e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199371
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and is responsible for ATP-dependent lysis of macrophages through the formation of membrane pores permeable to large molecules. Activation of this nuclear receptor by ATP in the cytoplasm may be a mechanism by which cellular activity can be coupled to changes in gene expression. Multiple alternatively spliced variants have been identified, most of which fit nonsense-mediated decay (NMD) criteria. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene are fertile and viable with no obvious phenotypic abnormality. Cellular responses of macrophages to extracellular ATP are frequently normal however. In addition, long bones are thinner than normal in adult mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 106,436,144 (GRCm39) S139G probably benign Het
Adrb3 T C 8: 27,717,405 (GRCm39) D348G probably damaging Het
Atg2b A G 12: 105,587,587 (GRCm39) V1959A probably benign Het
Bicral G A 17: 47,119,295 (GRCm39) T742M probably damaging Het
Bub1b T A 2: 118,435,912 (GRCm39) I60N probably damaging Het
Ccdc162 A G 10: 41,445,930 (GRCm39) V414A probably benign Het
Cd22 T G 7: 30,569,198 (GRCm39) Y612S probably damaging Het
Cd68 T A 11: 69,555,247 (GRCm39) I320F probably damaging Het
Clca3a2 A T 3: 144,503,393 (GRCm39) N852K probably benign Het
Cpa6 T A 1: 10,399,739 (GRCm39) H363L probably benign Het
Ddx18 A T 1: 121,489,087 (GRCm39) L320Q probably damaging Het
Dnah5 A G 15: 28,421,210 (GRCm39) D3849G probably benign Het
Eci1 T A 17: 24,656,283 (GRCm39) N164K probably damaging Het
Efs T C 14: 55,154,584 (GRCm39) T552A probably damaging Het
Fbp1 C A 13: 63,023,010 (GRCm39) V96L probably damaging Het
Gtf3c1 T A 7: 125,261,826 (GRCm39) N1139I probably benign Het
Gucy1b2 T C 14: 62,660,430 (GRCm39) Y152C probably damaging Het
Gxylt1 A T 15: 93,143,542 (GRCm39) L362Q probably damaging Het
Iqcd A G 5: 120,743,191 (GRCm39) probably null Het
Klhl41 T A 2: 69,513,876 (GRCm39) I585N possibly damaging Het
Map6 A G 7: 98,985,505 (GRCm39) K470E probably damaging Het
Mast3 T C 8: 71,238,865 (GRCm39) T496A probably damaging Het
Mbd6 A T 10: 127,121,155 (GRCm39) probably benign Het
Melk A G 4: 44,312,237 (GRCm39) K183R possibly damaging Het
Mta1 T C 12: 113,086,759 (GRCm39) V152A probably damaging Het
Naa35 G A 13: 59,770,680 (GRCm39) probably benign Het
Nav3 A C 10: 109,600,494 (GRCm39) S1378A probably damaging Het
Ncapd3 T A 9: 26,962,941 (GRCm39) D415E possibly damaging Het
Nlrp4f G A 13: 65,338,685 (GRCm39) R651* probably null Het
Or1e1f T A 11: 73,855,536 (GRCm39) M34K probably damaging Het
Or5b121 A G 19: 13,507,744 (GRCm39) T280A probably benign Het
Or5p72 A G 7: 108,021,825 (GRCm39) I16V probably benign Het
Phactr2 T C 10: 13,264,447 (GRCm39) D2G probably benign Het
Phc3 G T 3: 31,020,015 (GRCm39) S28R probably damaging Het
Ppfia1 A T 7: 144,073,711 (GRCm39) probably null Het
Prdm10 C T 9: 31,264,713 (GRCm39) T667M probably benign Het
Pwwp2b T A 7: 138,835,887 (GRCm39) S443T possibly damaging Het
Pzp T C 6: 128,467,035 (GRCm39) T1113A probably damaging Het
Rapgef6 A G 11: 54,526,962 (GRCm39) E551G possibly damaging Het
Sec23ip A G 7: 128,378,508 (GRCm39) Y774C probably damaging Het
Setdb2 T C 14: 59,656,567 (GRCm39) D266G probably damaging Het
Shank1 T C 7: 44,002,310 (GRCm39) V1343A probably benign Het
Slf2 T A 19: 44,961,674 (GRCm39) D1064E probably benign Het
Slu7 A G 11: 43,334,245 (GRCm39) K424E probably benign Het
Smg1 A T 7: 117,753,887 (GRCm39) probably benign Het
Sptlc2 A T 12: 87,393,535 (GRCm39) L264Q probably damaging Het
Sra1 A G 18: 36,811,460 (GRCm39) S93P probably damaging Het
Sult1c2 T C 17: 54,271,680 (GRCm39) E169G probably benign Het
Sv2a A G 3: 96,092,888 (GRCm39) D196G probably damaging Het
Tbc1d22b A G 17: 29,813,754 (GRCm39) I362M probably damaging Het
Tenm3 T C 8: 48,681,797 (GRCm39) D2611G probably damaging Het
Tmem43 T C 6: 91,457,690 (GRCm39) F191L probably benign Het
Trbv13-2 T A 6: 41,098,628 (GRCm39) Y68N probably benign Het
Ttn T G 2: 76,604,998 (GRCm39) D18312A possibly damaging Het
Ublcp1 A G 11: 44,356,433 (GRCm39) V95A probably damaging Het
Usp17ld A G 7: 102,900,047 (GRCm39) V295A probably damaging Het
Vmn1r29 T A 6: 58,285,152 (GRCm39) L291M possibly damaging Het
Vsig10l C T 7: 43,113,575 (GRCm39) R176* probably null Het
Zbtb46 A G 2: 181,065,210 (GRCm39) probably null Het
Zfp644 A G 5: 106,785,848 (GRCm39) V233A probably benign Het
Other mutations in P2rx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:P2rx7 APN 5 122,814,761 (GRCm39) missense probably damaging 1.00
IGL01911:P2rx7 APN 5 122,796,831 (GRCm39) missense probably damaging 0.99
IGL02375:P2rx7 APN 5 122,811,719 (GRCm39) splice site probably benign
IGL02502:P2rx7 APN 5 122,819,050 (GRCm39) missense possibly damaging 0.92
IGL03102:P2rx7 APN 5 122,801,668 (GRCm39) missense possibly damaging 0.88
IGL03179:P2rx7 APN 5 122,811,763 (GRCm39) missense possibly damaging 0.66
ailing UTSW 5 122,811,799 (GRCm39) missense probably benign
Enfermo UTSW 5 122,790,852 (GRCm39) missense probably damaging 0.98
Incapacitated UTSW 5 122,811,856 (GRCm39) missense probably damaging 0.99
Sickpuppy UTSW 5 122,819,066 (GRCm39) missense probably damaging 0.96
Stumped UTSW 5 122,790,789 (GRCm39) critical splice acceptor site probably null
BB009:P2rx7 UTSW 5 122,782,245 (GRCm39) missense probably benign 0.01
BB019:P2rx7 UTSW 5 122,782,245 (GRCm39) missense probably benign 0.01
PIT1430001:P2rx7 UTSW 5 122,819,279 (GRCm39) missense probably damaging 0.99
R0363:P2rx7 UTSW 5 122,795,093 (GRCm39) nonsense probably null
R0558:P2rx7 UTSW 5 122,811,861 (GRCm39) missense possibly damaging 0.83
R1186:P2rx7 UTSW 5 122,808,514 (GRCm39) missense probably damaging 1.00
R1709:P2rx7 UTSW 5 122,808,528 (GRCm39) missense possibly damaging 0.95
R1856:P2rx7 UTSW 5 122,819,095 (GRCm39) missense probably damaging 1.00
R1899:P2rx7 UTSW 5 122,811,799 (GRCm39) missense probably benign
R1905:P2rx7 UTSW 5 122,819,015 (GRCm39) missense probably damaging 1.00
R2082:P2rx7 UTSW 5 122,782,158 (GRCm39) missense possibly damaging 0.92
R2117:P2rx7 UTSW 5 122,819,329 (GRCm39) missense probably benign 0.00
R2205:P2rx7 UTSW 5 122,819,164 (GRCm39) missense probably damaging 1.00
R2446:P2rx7 UTSW 5 122,818,879 (GRCm39) missense probably benign
R3151:P2rx7 UTSW 5 122,819,329 (GRCm39) missense probably benign 0.00
R4052:P2rx7 UTSW 5 122,804,340 (GRCm39) missense probably damaging 1.00
R4883:P2rx7 UTSW 5 122,819,129 (GRCm39) missense probably damaging 1.00
R4930:P2rx7 UTSW 5 122,808,542 (GRCm39) missense probably damaging 1.00
R5194:P2rx7 UTSW 5 122,811,858 (GRCm39) missense probably benign 0.00
R5257:P2rx7 UTSW 5 122,819,066 (GRCm39) missense probably damaging 0.96
R5258:P2rx7 UTSW 5 122,819,066 (GRCm39) missense probably damaging 0.96
R5481:P2rx7 UTSW 5 122,818,883 (GRCm39) missense possibly damaging 0.89
R5738:P2rx7 UTSW 5 122,790,852 (GRCm39) missense probably damaging 0.98
R6587:P2rx7 UTSW 5 122,802,613 (GRCm39) missense probably damaging 1.00
R7098:P2rx7 UTSW 5 122,811,856 (GRCm39) missense probably damaging 0.99
R7120:P2rx7 UTSW 5 122,819,357 (GRCm39) missense probably benign
R7180:P2rx7 UTSW 5 122,818,883 (GRCm39) missense possibly damaging 0.89
R7358:P2rx7 UTSW 5 122,804,205 (GRCm39) critical splice acceptor site probably null
R7724:P2rx7 UTSW 5 122,811,436 (GRCm39) missense probably benign 0.07
R7932:P2rx7 UTSW 5 122,782,245 (GRCm39) missense probably benign 0.01
R8240:P2rx7 UTSW 5 122,793,096 (GRCm39) missense probably damaging 1.00
R8425:P2rx7 UTSW 5 122,808,521 (GRCm39) missense probably damaging 0.96
R9140:P2rx7 UTSW 5 122,790,789 (GRCm39) critical splice acceptor site probably null
R9331:P2rx7 UTSW 5 122,818,961 (GRCm39) missense probably benign 0.01
R9623:P2rx7 UTSW 5 122,790,860 (GRCm39) missense probably damaging 1.00
Z1177:P2rx7 UTSW 5 122,801,704 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGATCTTGCTTGGGGC -3'
(R):5'- AACCGTGATCGCAGCTTATTC -3'

Sequencing Primer
(F):5'- CTGTAATTTGAAGGCCAGCC -3'
(R):5'- GTGATCGCAGCTTATTCTTTCCCAC -3'
Posted On 2016-11-09