Incidental Mutation 'R5656:Pzp'
ID 442317
Institutional Source Beutler Lab
Gene Symbol Pzp
Ensembl Gene ENSMUSG00000030359
Gene Name PZP, alpha-2-macroglobulin like
Synonyms
MMRRC Submission 043302-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R5656 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 128483567-128526720 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128490072 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1113 (T1113A)
Ref Sequence ENSEMBL: ENSMUSP00000107760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112132]
AlphaFold Q61838
Predicted Effect probably damaging
Transcript: ENSMUST00000112132
AA Change: T1113A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107760
Gene: ENSMUSG00000030359
AA Change: T1113A

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
Pfam:A2M_N 126 219 3.2e-23 PFAM
low complexity region 327 338 N/A INTRINSIC
A2M_N_2 458 606 6.18e-40 SMART
A2M 750 840 2.27e-38 SMART
Pfam:Thiol-ester_cl 973 1003 4e-19 PFAM
Pfam:A2M_comp 1022 1284 2.1e-90 PFAM
A2M_recep 1395 1482 6.47e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204291
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes mutant null mice show higher bone mineral density, hypoactivity, and decreased heart rate. Mice homozygous for a different null allele show resistance to the lethal effects of endotoxin, increased susceptibility to diet-induced acute pancreatitis, and altered LPS-induced febrile and cytokine responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 (GRCm38) S139G probably benign Het
Adrb3 T C 8: 27,227,377 (GRCm38) D348G probably damaging Het
Atg2b A G 12: 105,621,328 (GRCm38) V1959A probably benign Het
Bicral G A 17: 46,808,369 (GRCm38) T742M probably damaging Het
Bub1b T A 2: 118,605,431 (GRCm38) I60N probably damaging Het
Ccdc162 A G 10: 41,569,934 (GRCm38) V414A probably benign Het
Cd22 T G 7: 30,869,773 (GRCm38) Y612S probably damaging Het
Cd68 T A 11: 69,664,421 (GRCm38) I320F probably damaging Het
Clca3a2 A T 3: 144,797,632 (GRCm38) N852K probably benign Het
Cpa6 T A 1: 10,329,514 (GRCm38) H363L probably benign Het
Ddx18 A T 1: 121,561,358 (GRCm38) L320Q probably damaging Het
Dnah5 A G 15: 28,421,064 (GRCm38) D3849G probably benign Het
Eci1 T A 17: 24,437,309 (GRCm38) N164K probably damaging Het
Efs T C 14: 54,917,127 (GRCm38) T552A probably damaging Het
Fbp1 C A 13: 62,875,196 (GRCm38) V96L probably damaging Het
Gtf3c1 T A 7: 125,662,654 (GRCm38) N1139I probably benign Het
Gucy1b2 T C 14: 62,422,981 (GRCm38) Y152C probably damaging Het
Gxylt1 A T 15: 93,245,661 (GRCm38) L362Q probably damaging Het
Iqcd A G 5: 120,605,126 (GRCm38) probably null Het
Klhl41 T A 2: 69,683,532 (GRCm38) I585N possibly damaging Het
Map6 A G 7: 99,336,298 (GRCm38) K470E probably damaging Het
Mast3 T C 8: 70,786,221 (GRCm38) T496A probably damaging Het
Mbd6 A T 10: 127,285,286 (GRCm38) probably benign Het
Melk A G 4: 44,312,237 (GRCm38) K183R possibly damaging Het
Mta1 T C 12: 113,123,139 (GRCm38) V152A probably damaging Het
Naa35 G A 13: 59,622,866 (GRCm38) probably benign Het
Nav3 A C 10: 109,764,633 (GRCm38) S1378A probably damaging Het
Ncapd3 T A 9: 27,051,645 (GRCm38) D415E possibly damaging Het
Nlrp4f G A 13: 65,190,871 (GRCm38) R651* probably null Het
Olfr1480 A G 19: 13,530,380 (GRCm38) T280A probably benign Het
Olfr397 T A 11: 73,964,710 (GRCm38) M34K probably damaging Het
Olfr497 A G 7: 108,422,618 (GRCm38) I16V probably benign Het
P2rx7 A T 5: 122,673,717 (GRCm38) R364W probably damaging Het
Phactr2 T C 10: 13,388,703 (GRCm38) D2G probably benign Het
Phc3 G T 3: 30,965,866 (GRCm38) S28R probably damaging Het
Ppfia1 A T 7: 144,519,974 (GRCm38) probably null Het
Prdm10 C T 9: 31,353,417 (GRCm38) T667M probably benign Het
Pwwp2b T A 7: 139,255,971 (GRCm38) S443T possibly damaging Het
Rapgef6 A G 11: 54,636,136 (GRCm38) E551G possibly damaging Het
Sec23ip A G 7: 128,776,784 (GRCm38) Y774C probably damaging Het
Setdb2 T C 14: 59,419,118 (GRCm38) D266G probably damaging Het
Shank1 T C 7: 44,352,886 (GRCm38) V1343A probably benign Het
Slf2 T A 19: 44,973,235 (GRCm38) D1064E probably benign Het
Slu7 A G 11: 43,443,418 (GRCm38) K424E probably benign Het
Smg1 A T 7: 118,154,664 (GRCm38) probably benign Het
Sptlc2 A T 12: 87,346,761 (GRCm38) L264Q probably damaging Het
Sra1 A G 18: 36,678,407 (GRCm38) S93P probably damaging Het
Sult1c1 T C 17: 53,964,652 (GRCm38) E169G probably benign Het
Sv2a A G 3: 96,185,572 (GRCm38) D196G probably damaging Het
Tbc1d22b A G 17: 29,594,780 (GRCm38) I362M probably damaging Het
Tenm3 T C 8: 48,228,762 (GRCm38) D2611G probably damaging Het
Tmem43 T C 6: 91,480,708 (GRCm38) F191L probably benign Het
Trbv13-2 T A 6: 41,121,694 (GRCm38) Y68N probably benign Het
Ttn T G 2: 76,774,654 (GRCm38) D18312A possibly damaging Het
Ublcp1 A G 11: 44,465,606 (GRCm38) V95A probably damaging Het
Usp17ld A G 7: 103,250,840 (GRCm38) V295A probably damaging Het
Vmn1r29 T A 6: 58,308,167 (GRCm38) L291M possibly damaging Het
Vsig10l C T 7: 43,464,151 (GRCm38) R176* probably null Het
Zbtb46 A G 2: 181,423,417 (GRCm38) probably null Het
Zfp644 A G 5: 106,637,982 (GRCm38) V233A probably benign Het
Other mutations in Pzp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Pzp APN 6 128,516,909 (GRCm38) missense probably benign 0.25
IGL01470:Pzp APN 6 128,521,124 (GRCm38) missense probably benign 0.05
IGL01753:Pzp APN 6 128,502,183 (GRCm38) missense possibly damaging 0.78
IGL01878:Pzp APN 6 128,495,298 (GRCm38) missense probably damaging 1.00
IGL02307:Pzp APN 6 128,489,086 (GRCm38) nonsense probably null
IGL02338:Pzp APN 6 128,486,170 (GRCm38) missense probably benign 0.07
IGL02546:Pzp APN 6 128,494,699 (GRCm38) splice site probably benign
IGL02598:Pzp APN 6 128,487,457 (GRCm38) missense probably benign 0.00
IGL02699:Pzp APN 6 128,487,401 (GRCm38) critical splice donor site probably null
lilibet UTSW 6 128,513,773 (GRCm38) missense probably damaging 0.99
P4748:Pzp UTSW 6 128,490,089 (GRCm38) missense probably damaging 1.00
PIT4151001:Pzp UTSW 6 128,525,296 (GRCm38) missense probably benign 0.34
PIT4495001:Pzp UTSW 6 128,502,229 (GRCm38) missense probably benign
R0157:Pzp UTSW 6 128,523,976 (GRCm38) nonsense probably null
R0195:Pzp UTSW 6 128,487,478 (GRCm38) missense probably damaging 1.00
R0238:Pzp UTSW 6 128,489,156 (GRCm38) splice site probably benign
R0239:Pzp UTSW 6 128,489,156 (GRCm38) splice site probably benign
R0271:Pzp UTSW 6 128,519,514 (GRCm38) missense probably damaging 1.00
R0299:Pzp UTSW 6 128,495,330 (GRCm38) splice site probably benign
R0744:Pzp UTSW 6 128,516,195 (GRCm38) unclassified probably benign
R0968:Pzp UTSW 6 128,525,145 (GRCm38) missense probably benign 0.00
R1037:Pzp UTSW 6 128,519,426 (GRCm38) missense probably benign 0.01
R1074:Pzp UTSW 6 128,487,924 (GRCm38) missense probably benign 0.20
R1469:Pzp UTSW 6 128,512,356 (GRCm38) missense probably benign 0.04
R1469:Pzp UTSW 6 128,512,356 (GRCm38) missense probably benign 0.04
R1579:Pzp UTSW 6 128,523,968 (GRCm38) critical splice donor site probably null
R1646:Pzp UTSW 6 128,503,555 (GRCm38) missense probably benign 0.33
R1770:Pzp UTSW 6 128,485,617 (GRCm38) missense probably damaging 1.00
R1777:Pzp UTSW 6 128,490,572 (GRCm38) missense possibly damaging 0.85
R1786:Pzp UTSW 6 128,491,161 (GRCm38) splice site probably null
R1854:Pzp UTSW 6 128,502,225 (GRCm38) missense probably damaging 1.00
R2001:Pzp UTSW 6 128,516,120 (GRCm38) missense probably benign 0.01
R2060:Pzp UTSW 6 128,483,710 (GRCm38) missense probably benign 0.45
R2081:Pzp UTSW 6 128,519,420 (GRCm38) missense probably benign 0.00
R2130:Pzp UTSW 6 128,491,161 (GRCm38) splice site probably null
R2131:Pzp UTSW 6 128,491,161 (GRCm38) splice site probably null
R2160:Pzp UTSW 6 128,525,276 (GRCm38) missense probably damaging 1.00
R2168:Pzp UTSW 6 128,488,047 (GRCm38) missense probably damaging 0.98
R2328:Pzp UTSW 6 128,510,390 (GRCm38) missense possibly damaging 0.79
R2441:Pzp UTSW 6 128,489,768 (GRCm38) nonsense probably null
R2866:Pzp UTSW 6 128,525,264 (GRCm38) missense possibly damaging 0.76
R2869:Pzp UTSW 6 128,485,556 (GRCm38) critical splice donor site probably null
R2869:Pzp UTSW 6 128,485,556 (GRCm38) critical splice donor site probably null
R2870:Pzp UTSW 6 128,485,556 (GRCm38) critical splice donor site probably null
R2870:Pzp UTSW 6 128,485,556 (GRCm38) critical splice donor site probably null
R2873:Pzp UTSW 6 128,485,556 (GRCm38) critical splice donor site probably null
R2876:Pzp UTSW 6 128,491,550 (GRCm38) missense probably damaging 1.00
R3404:Pzp UTSW 6 128,513,806 (GRCm38) missense probably damaging 1.00
R4452:Pzp UTSW 6 128,491,240 (GRCm38) missense probably damaging 1.00
R4461:Pzp UTSW 6 128,524,040 (GRCm38) missense probably benign 0.02
R5103:Pzp UTSW 6 128,502,229 (GRCm38) missense probably benign 0.04
R5193:Pzp UTSW 6 128,502,334 (GRCm38) missense probably benign 0.00
R5425:Pzp UTSW 6 128,489,048 (GRCm38) missense probably damaging 0.97
R5465:Pzp UTSW 6 128,486,961 (GRCm38) missense probably damaging 1.00
R5590:Pzp UTSW 6 128,523,796 (GRCm38) missense probably damaging 1.00
R5697:Pzp UTSW 6 128,525,189 (GRCm38) missense probably benign 0.03
R5854:Pzp UTSW 6 128,506,869 (GRCm38) missense probably benign 0.01
R5994:Pzp UTSW 6 128,491,597 (GRCm38) missense probably damaging 1.00
R6042:Pzp UTSW 6 128,524,014 (GRCm38) missense possibly damaging 0.75
R6054:Pzp UTSW 6 128,513,764 (GRCm38) missense probably benign 0.03
R6153:Pzp UTSW 6 128,489,016 (GRCm38) missense probably benign
R6465:Pzp UTSW 6 128,491,619 (GRCm38) missense probably damaging 1.00
R6719:Pzp UTSW 6 128,524,083 (GRCm38) missense probably benign 0.17
R6722:Pzp UTSW 6 128,487,954 (GRCm38) missense probably damaging 1.00
R7316:Pzp UTSW 6 128,513,773 (GRCm38) missense probably damaging 0.99
R7453:Pzp UTSW 6 128,486,916 (GRCm38) missense probably damaging 1.00
R7826:Pzp UTSW 6 128,487,533 (GRCm38) missense probably benign 0.38
R7878:Pzp UTSW 6 128,512,311 (GRCm38) missense possibly damaging 0.50
R7879:Pzp UTSW 6 128,489,016 (GRCm38) missense probably benign
R8113:Pzp UTSW 6 128,513,731 (GRCm38) splice site probably null
R8163:Pzp UTSW 6 128,512,194 (GRCm38) missense probably benign 0.00
R8471:Pzp UTSW 6 128,487,448 (GRCm38) missense probably benign 0.14
R8680:Pzp UTSW 6 128,496,046 (GRCm38) missense probably benign 0.00
R8795:Pzp UTSW 6 128,494,738 (GRCm38) missense probably damaging 1.00
R8844:Pzp UTSW 6 128,523,987 (GRCm38) missense probably damaging 1.00
R8964:Pzp UTSW 6 128,487,499 (GRCm38) missense probably benign 0.05
R9043:Pzp UTSW 6 128,494,779 (GRCm38) missense probably damaging 1.00
R9172:Pzp UTSW 6 128,525,209 (GRCm38) missense probably benign 0.01
R9205:Pzp UTSW 6 128,496,663 (GRCm38) missense probably benign 0.02
R9276:Pzp UTSW 6 128,522,114 (GRCm38) missense probably damaging 1.00
R9432:Pzp UTSW 6 128,522,165 (GRCm38) missense
R9444:Pzp UTSW 6 128,510,399 (GRCm38) missense
R9517:Pzp UTSW 6 128,512,154 (GRCm38) critical splice donor site probably null
R9721:Pzp UTSW 6 128,495,191 (GRCm38) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCAAAATAGAGCATTTCGCAC -3'
(R):5'- GATGCACGCATATACACACG -3'

Sequencing Primer
(F):5'- TAGAGCATTTCGCACAGCACTG -3'
(R):5'- ACGCATATACACACGATTTTAAAATC -3'
Posted On 2016-11-09