Incidental Mutation 'R5656:Ncapd3'
ID 442332
Institutional Source Beutler Lab
Gene Symbol Ncapd3
Ensembl Gene ENSMUSG00000035024
Gene Name non-SMC condensin II complex, subunit D3
Synonyms 4632407J06Rik, 2810487N22Rik, B130055D15Rik
MMRRC Submission 043302-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R5656 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 26941471-27006611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 26962941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 415 (D415E)
Ref Sequence ENSEMBL: ENSMUSP00000083374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073127] [ENSMUST00000086198] [ENSMUST00000216677]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000073127
AA Change: D415E

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000072871
Gene: ENSMUSG00000035024
AA Change: D415E

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cnd1 949 1148 1.7e-46 PFAM
low complexity region 1192 1200 N/A INTRINSIC
coiled coil region 1213 1270 N/A INTRINSIC
low complexity region 1290 1315 N/A INTRINSIC
low complexity region 1393 1410 N/A INTRINSIC
low complexity region 1485 1498 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086198
AA Change: D415E

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000083374
Gene: ENSMUSG00000035024
AA Change: D415E

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cohesin_HEAT 536 560 4.6e-5 PFAM
Pfam:Cnd1 949 1148 6.6e-59 PFAM
low complexity region 1192 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216677
AA Change: D415E

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217311
Meta Mutation Damage Score 0.4382 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Condensin complexes I and II play essential roles in mitotic chromosome assembly and segregation. Both condensins contain 2 invariant structural maintenance of chromosome (SMC) subunits, SMC2 (MIM 605576) and SMC4 (MIM 605575), but they contain different sets of non-SMC subunits. NCAPD3 is 1 of 3 non-SMC subunits that define condensin II (Ono et al., 2003 [PubMed 14532007]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 106,436,144 (GRCm39) S139G probably benign Het
Adrb3 T C 8: 27,717,405 (GRCm39) D348G probably damaging Het
Atg2b A G 12: 105,587,587 (GRCm39) V1959A probably benign Het
Bicral G A 17: 47,119,295 (GRCm39) T742M probably damaging Het
Bub1b T A 2: 118,435,912 (GRCm39) I60N probably damaging Het
Ccdc162 A G 10: 41,445,930 (GRCm39) V414A probably benign Het
Cd22 T G 7: 30,569,198 (GRCm39) Y612S probably damaging Het
Cd68 T A 11: 69,555,247 (GRCm39) I320F probably damaging Het
Clca3a2 A T 3: 144,503,393 (GRCm39) N852K probably benign Het
Cpa6 T A 1: 10,399,739 (GRCm39) H363L probably benign Het
Ddx18 A T 1: 121,489,087 (GRCm39) L320Q probably damaging Het
Dnah5 A G 15: 28,421,210 (GRCm39) D3849G probably benign Het
Eci1 T A 17: 24,656,283 (GRCm39) N164K probably damaging Het
Efs T C 14: 55,154,584 (GRCm39) T552A probably damaging Het
Fbp1 C A 13: 63,023,010 (GRCm39) V96L probably damaging Het
Gtf3c1 T A 7: 125,261,826 (GRCm39) N1139I probably benign Het
Gucy1b2 T C 14: 62,660,430 (GRCm39) Y152C probably damaging Het
Gxylt1 A T 15: 93,143,542 (GRCm39) L362Q probably damaging Het
Iqcd A G 5: 120,743,191 (GRCm39) probably null Het
Klhl41 T A 2: 69,513,876 (GRCm39) I585N possibly damaging Het
Map6 A G 7: 98,985,505 (GRCm39) K470E probably damaging Het
Mast3 T C 8: 71,238,865 (GRCm39) T496A probably damaging Het
Mbd6 A T 10: 127,121,155 (GRCm39) probably benign Het
Melk A G 4: 44,312,237 (GRCm39) K183R possibly damaging Het
Mta1 T C 12: 113,086,759 (GRCm39) V152A probably damaging Het
Naa35 G A 13: 59,770,680 (GRCm39) probably benign Het
Nav3 A C 10: 109,600,494 (GRCm39) S1378A probably damaging Het
Nlrp4f G A 13: 65,338,685 (GRCm39) R651* probably null Het
Or1e1f T A 11: 73,855,536 (GRCm39) M34K probably damaging Het
Or5b121 A G 19: 13,507,744 (GRCm39) T280A probably benign Het
Or5p72 A G 7: 108,021,825 (GRCm39) I16V probably benign Het
P2rx7 A T 5: 122,811,780 (GRCm39) R364W probably damaging Het
Phactr2 T C 10: 13,264,447 (GRCm39) D2G probably benign Het
Phc3 G T 3: 31,020,015 (GRCm39) S28R probably damaging Het
Ppfia1 A T 7: 144,073,711 (GRCm39) probably null Het
Prdm10 C T 9: 31,264,713 (GRCm39) T667M probably benign Het
Pwwp2b T A 7: 138,835,887 (GRCm39) S443T possibly damaging Het
Pzp T C 6: 128,467,035 (GRCm39) T1113A probably damaging Het
Rapgef6 A G 11: 54,526,962 (GRCm39) E551G possibly damaging Het
Sec23ip A G 7: 128,378,508 (GRCm39) Y774C probably damaging Het
Setdb2 T C 14: 59,656,567 (GRCm39) D266G probably damaging Het
Shank1 T C 7: 44,002,310 (GRCm39) V1343A probably benign Het
Slf2 T A 19: 44,961,674 (GRCm39) D1064E probably benign Het
Slu7 A G 11: 43,334,245 (GRCm39) K424E probably benign Het
Smg1 A T 7: 117,753,887 (GRCm39) probably benign Het
Sptlc2 A T 12: 87,393,535 (GRCm39) L264Q probably damaging Het
Sra1 A G 18: 36,811,460 (GRCm39) S93P probably damaging Het
Sult1c2 T C 17: 54,271,680 (GRCm39) E169G probably benign Het
Sv2a A G 3: 96,092,888 (GRCm39) D196G probably damaging Het
Tbc1d22b A G 17: 29,813,754 (GRCm39) I362M probably damaging Het
Tenm3 T C 8: 48,681,797 (GRCm39) D2611G probably damaging Het
Tmem43 T C 6: 91,457,690 (GRCm39) F191L probably benign Het
Trbv13-2 T A 6: 41,098,628 (GRCm39) Y68N probably benign Het
Ttn T G 2: 76,604,998 (GRCm39) D18312A possibly damaging Het
Ublcp1 A G 11: 44,356,433 (GRCm39) V95A probably damaging Het
Usp17ld A G 7: 102,900,047 (GRCm39) V295A probably damaging Het
Vmn1r29 T A 6: 58,285,152 (GRCm39) L291M possibly damaging Het
Vsig10l C T 7: 43,113,575 (GRCm39) R176* probably null Het
Zbtb46 A G 2: 181,065,210 (GRCm39) probably null Het
Zfp644 A G 5: 106,785,848 (GRCm39) V233A probably benign Het
Other mutations in Ncapd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Ncapd3 APN 9 26,963,649 (GRCm39) missense probably benign
IGL00544:Ncapd3 APN 9 26,974,634 (GRCm39) missense possibly damaging 0.94
IGL01657:Ncapd3 APN 9 26,983,120 (GRCm39) missense possibly damaging 0.81
IGL01979:Ncapd3 APN 9 26,983,261 (GRCm39) critical splice donor site probably null
IGL02073:Ncapd3 APN 9 26,974,612 (GRCm39) missense probably benign 0.03
IGL02083:Ncapd3 APN 9 26,963,117 (GRCm39) missense probably damaging 1.00
IGL02383:Ncapd3 APN 9 26,961,624 (GRCm39) missense probably benign 0.44
IGL02429:Ncapd3 APN 9 27,000,598 (GRCm39) missense probably benign 0.08
IGL02437:Ncapd3 APN 9 26,975,264 (GRCm39) splice site probably benign
IGL02861:Ncapd3 APN 9 26,981,195 (GRCm39) missense probably benign 0.00
IGL03202:Ncapd3 APN 9 26,983,011 (GRCm39) splice site probably benign
IGL03219:Ncapd3 APN 9 26,975,169 (GRCm39) splice site probably benign
IGL03252:Ncapd3 APN 9 26,962,745 (GRCm39) missense probably damaging 1.00
pevensie UTSW 9 26,997,342 (GRCm39) missense probably damaging 1.00
R0015:Ncapd3 UTSW 9 26,963,105 (GRCm39) missense probably damaging 1.00
R0015:Ncapd3 UTSW 9 26,963,105 (GRCm39) missense probably damaging 1.00
R0084:Ncapd3 UTSW 9 26,967,407 (GRCm39) missense probably damaging 0.98
R0491:Ncapd3 UTSW 9 26,969,179 (GRCm39) missense probably damaging 0.97
R0513:Ncapd3 UTSW 9 26,975,401 (GRCm39) splice site probably benign
R0565:Ncapd3 UTSW 9 26,999,294 (GRCm39) missense probably benign 0.00
R0601:Ncapd3 UTSW 9 26,952,803 (GRCm39) missense probably benign 0.05
R0671:Ncapd3 UTSW 9 26,998,773 (GRCm39) missense probably benign 0.00
R0673:Ncapd3 UTSW 9 26,998,773 (GRCm39) missense probably benign 0.00
R0842:Ncapd3 UTSW 9 26,948,380 (GRCm39) missense probably benign 0.01
R1178:Ncapd3 UTSW 9 26,952,717 (GRCm39) missense probably benign
R1366:Ncapd3 UTSW 9 26,969,236 (GRCm39) missense probably damaging 1.00
R1432:Ncapd3 UTSW 9 26,981,168 (GRCm39) splice site probably benign
R1439:Ncapd3 UTSW 9 26,998,862 (GRCm39) critical splice donor site probably null
R1532:Ncapd3 UTSW 9 26,994,656 (GRCm39) nonsense probably null
R2131:Ncapd3 UTSW 9 26,994,642 (GRCm39) missense probably damaging 0.98
R2178:Ncapd3 UTSW 9 26,999,845 (GRCm39) missense probably benign 0.01
R2238:Ncapd3 UTSW 9 26,978,320 (GRCm39) missense probably benign
R2258:Ncapd3 UTSW 9 26,967,368 (GRCm39) missense probably benign 0.16
R2259:Ncapd3 UTSW 9 26,967,368 (GRCm39) missense probably benign 0.16
R2260:Ncapd3 UTSW 9 26,967,368 (GRCm39) missense probably benign 0.16
R2297:Ncapd3 UTSW 9 26,952,797 (GRCm39) nonsense probably null
R2877:Ncapd3 UTSW 9 26,955,783 (GRCm39) splice site probably null
R3612:Ncapd3 UTSW 9 26,961,653 (GRCm39) missense probably damaging 1.00
R3709:Ncapd3 UTSW 9 26,963,645 (GRCm39) missense probably benign 0.00
R3791:Ncapd3 UTSW 9 26,963,931 (GRCm39) missense probably benign 0.27
R4052:Ncapd3 UTSW 9 27,000,679 (GRCm39) splice site probably null
R4297:Ncapd3 UTSW 9 26,963,623 (GRCm39) missense probably benign
R4299:Ncapd3 UTSW 9 26,963,623 (GRCm39) missense probably benign
R4441:Ncapd3 UTSW 9 26,962,941 (GRCm39) missense possibly damaging 0.81
R4572:Ncapd3 UTSW 9 27,005,911 (GRCm39) missense probably damaging 1.00
R4675:Ncapd3 UTSW 9 27,006,038 (GRCm39) unclassified probably benign
R4790:Ncapd3 UTSW 9 26,963,146 (GRCm39) missense probably benign 0.00
R4835:Ncapd3 UTSW 9 26,997,342 (GRCm39) missense probably damaging 1.00
R4919:Ncapd3 UTSW 9 26,963,071 (GRCm39) missense possibly damaging 0.95
R4928:Ncapd3 UTSW 9 26,983,031 (GRCm39) nonsense probably null
R4939:Ncapd3 UTSW 9 26,975,165 (GRCm39) critical splice donor site probably null
R4980:Ncapd3 UTSW 9 26,974,591 (GRCm39) missense probably damaging 0.99
R5030:Ncapd3 UTSW 9 26,983,062 (GRCm39) missense probably damaging 0.98
R5052:Ncapd3 UTSW 9 26,963,015 (GRCm39) missense probably damaging 1.00
R5180:Ncapd3 UTSW 9 26,962,941 (GRCm39) missense possibly damaging 0.81
R5343:Ncapd3 UTSW 9 26,999,349 (GRCm39) small deletion probably benign
R5840:Ncapd3 UTSW 9 27,006,054 (GRCm39) missense probably benign 0.00
R5900:Ncapd3 UTSW 9 26,978,265 (GRCm39) missense probably benign 0.26
R6093:Ncapd3 UTSW 9 26,967,454 (GRCm39) missense probably damaging 0.99
R6122:Ncapd3 UTSW 9 26,975,278 (GRCm39) missense probably benign 0.00
R6249:Ncapd3 UTSW 9 26,999,349 (GRCm39) small deletion probably benign
R6428:Ncapd3 UTSW 9 26,963,960 (GRCm39) splice site probably null
R6432:Ncapd3 UTSW 9 26,955,805 (GRCm39) missense probably damaging 0.98
R6441:Ncapd3 UTSW 9 26,974,712 (GRCm39) missense probably benign 0.03
R6459:Ncapd3 UTSW 9 26,963,051 (GRCm39) missense probably benign 0.00
R6567:Ncapd3 UTSW 9 26,978,300 (GRCm39) missense possibly damaging 0.83
R6722:Ncapd3 UTSW 9 26,998,852 (GRCm39) missense probably benign
R6862:Ncapd3 UTSW 9 26,942,105 (GRCm39) missense probably damaging 0.98
R7234:Ncapd3 UTSW 9 26,961,655 (GRCm39) missense probably damaging 0.97
R7286:Ncapd3 UTSW 9 26,981,254 (GRCm39) missense probably damaging 1.00
R7404:Ncapd3 UTSW 9 26,978,315 (GRCm39) missense probably benign 0.01
R7541:Ncapd3 UTSW 9 26,978,336 (GRCm39) missense probably damaging 0.99
R7583:Ncapd3 UTSW 9 26,983,144 (GRCm39) missense probably damaging 1.00
R7655:Ncapd3 UTSW 9 26,966,801 (GRCm39) missense possibly damaging 0.47
R7656:Ncapd3 UTSW 9 26,966,801 (GRCm39) missense possibly damaging 0.47
R7815:Ncapd3 UTSW 9 26,974,736 (GRCm39) nonsense probably null
R7876:Ncapd3 UTSW 9 26,956,519 (GRCm39) critical splice donor site probably null
R7913:Ncapd3 UTSW 9 26,959,522 (GRCm39) nonsense probably null
R8068:Ncapd3 UTSW 9 26,974,657 (GRCm39) missense possibly damaging 0.66
R8147:Ncapd3 UTSW 9 26,942,014 (GRCm39) start gained probably benign
R8197:Ncapd3 UTSW 9 26,997,329 (GRCm39) missense probably damaging 0.98
R8264:Ncapd3 UTSW 9 27,006,038 (GRCm39) unclassified probably benign
R8353:Ncapd3 UTSW 9 26,983,100 (GRCm39) missense probably benign 0.03
R8539:Ncapd3 UTSW 9 26,959,520 (GRCm39) missense probably benign
R8839:Ncapd3 UTSW 9 27,005,730 (GRCm39) missense
R8917:Ncapd3 UTSW 9 26,999,297 (GRCm39) missense probably benign
R8997:Ncapd3 UTSW 9 26,959,577 (GRCm39) missense probably damaging 1.00
R9215:Ncapd3 UTSW 9 26,975,386 (GRCm39) missense possibly damaging 0.51
R9393:Ncapd3 UTSW 9 26,962,682 (GRCm39) missense possibly damaging 0.54
R9412:Ncapd3 UTSW 9 26,967,451 (GRCm39) nonsense probably null
R9688:Ncapd3 UTSW 9 26,967,349 (GRCm39) missense probably benign 0.01
R9746:Ncapd3 UTSW 9 26,974,655 (GRCm39) missense probably benign
R9749:Ncapd3 UTSW 9 26,956,873 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGCCACATTCATTGCCTGGC -3'
(R):5'- ATGTGTTGCTAGAAGACAACTCC -3'

Sequencing Primer
(F):5'- GCCTGGCTTTACAAATATTCACG -3'
(R):5'- CTCCAGACAATGTGCAAAGCTGG -3'
Posted On 2016-11-09