Incidental Mutation 'R5656:Mbd6'
ID442338
Institutional Source Beutler Lab
Gene Symbol Mbd6
Ensembl Gene ENSMUSG00000025409
Gene Namemethyl-CpG binding domain protein 6
SynonymsD10Wsu93e
MMRRC Submission 043302-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5656 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127281956-127289018 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 127285286 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026476] [ENSMUST00000026479] [ENSMUST00000119078] [ENSMUST00000156208] [ENSMUST00000172567]
Predicted Effect unknown
Transcript: ENSMUST00000026476
AA Change: D499E
SMART Domains Protein: ENSMUSP00000026476
Gene: ENSMUSG00000025409
AA Change: D499E

DomainStartEndE-ValueType
Blast:MBD 26 79 8e-10 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 269 295 N/A INTRINSIC
low complexity region 311 342 N/A INTRINSIC
low complexity region 347 378 N/A INTRINSIC
low complexity region 383 428 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 461 498 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 634 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
low complexity region 653 674 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 733 799 N/A INTRINSIC
low complexity region 815 849 N/A INTRINSIC
low complexity region 853 890 N/A INTRINSIC
low complexity region 949 958 N/A INTRINSIC
low complexity region 978 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026479
SMART Domains Protein: ENSMUSP00000026479
Gene: ENSMUSG00000025410

DomainStartEndE-ValueType
Pfam:Dynamitin 16 400 7.1e-129 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000119078
AA Change: D499E
SMART Domains Protein: ENSMUSP00000112805
Gene: ENSMUSG00000025409
AA Change: D499E

DomainStartEndE-ValueType
Blast:MBD 26 79 8e-10 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 269 295 N/A INTRINSIC
low complexity region 311 342 N/A INTRINSIC
low complexity region 347 378 N/A INTRINSIC
low complexity region 383 428 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 461 498 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 634 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
low complexity region 653 674 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 733 798 N/A INTRINSIC
low complexity region 813 847 N/A INTRINSIC
low complexity region 851 888 N/A INTRINSIC
low complexity region 947 956 N/A INTRINSIC
low complexity region 976 1000 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000126243
AA Change: D146E
SMART Domains Protein: ENSMUSP00000115238
Gene: ENSMUSG00000025409
AA Change: D146E

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
low complexity region 31 76 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 109 146 N/A INTRINSIC
low complexity region 148 165 N/A INTRINSIC
low complexity region 181 211 N/A INTRINSIC
low complexity region 214 282 N/A INTRINSIC
low complexity region 284 300 N/A INTRINSIC
low complexity region 301 322 N/A INTRINSIC
low complexity region 324 334 N/A INTRINSIC
low complexity region 381 446 N/A INTRINSIC
low complexity region 462 496 N/A INTRINSIC
low complexity region 500 537 N/A INTRINSIC
low complexity region 596 610 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136169
SMART Domains Protein: ENSMUSP00000122504
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 55 64 N/A INTRINSIC
low complexity region 84 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154851
SMART Domains Protein: ENSMUSP00000133835
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 2 61 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
low complexity region 101 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156208
SMART Domains Protein: ENSMUSP00000114590
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
SCOP:d1qk9a_ 22 88 6e-5 SMART
Blast:MBD 26 79 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172567
SMART Domains Protein: ENSMUSP00000134527
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 1 66 N/A INTRINSIC
low complexity region 81 115 N/A INTRINSIC
low complexity region 119 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218752
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Adrb3 T C 8: 27,227,377 D348G probably damaging Het
Atg2b A G 12: 105,621,328 V1959A probably benign Het
Bicral G A 17: 46,808,369 T742M probably damaging Het
Bub1b T A 2: 118,605,431 I60N probably damaging Het
Ccdc162 A G 10: 41,569,934 V414A probably benign Het
Cd22 T G 7: 30,869,773 Y612S probably damaging Het
Cd68 T A 11: 69,664,421 I320F probably damaging Het
Clca3a2 A T 3: 144,797,632 N852K probably benign Het
Cpa6 T A 1: 10,329,514 H363L probably benign Het
Ddx18 A T 1: 121,561,358 L320Q probably damaging Het
Dnah5 A G 15: 28,421,064 D3849G probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Efs T C 14: 54,917,127 T552A probably damaging Het
Fbp1 C A 13: 62,875,196 V96L probably damaging Het
Gtf3c1 T A 7: 125,662,654 N1139I probably benign Het
Gucy1b2 T C 14: 62,422,981 Y152C probably damaging Het
Gxylt1 A T 15: 93,245,661 L362Q probably damaging Het
Iqcd A G 5: 120,605,126 probably null Het
Klhl41 T A 2: 69,683,532 I585N possibly damaging Het
Map6 A G 7: 99,336,298 K470E probably damaging Het
Mast3 T C 8: 70,786,221 T496A probably damaging Het
Melk A G 4: 44,312,237 K183R possibly damaging Het
Mta1 T C 12: 113,123,139 V152A probably damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Nav3 A C 10: 109,764,633 S1378A probably damaging Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Nlrp4f G A 13: 65,190,871 R651* probably null Het
Olfr1480 A G 19: 13,530,380 T280A probably benign Het
Olfr397 T A 11: 73,964,710 M34K probably damaging Het
Olfr497 A G 7: 108,422,618 I16V probably benign Het
P2rx7 A T 5: 122,673,717 R364W probably damaging Het
Phactr2 T C 10: 13,388,703 D2G probably benign Het
Phc3 G T 3: 30,965,866 S28R probably damaging Het
Ppfia1 A T 7: 144,519,974 probably null Het
Prdm10 C T 9: 31,353,417 T667M probably benign Het
Pwwp2b T A 7: 139,255,971 S443T possibly damaging Het
Pzp T C 6: 128,490,072 T1113A probably damaging Het
Rapgef6 A G 11: 54,636,136 E551G possibly damaging Het
Sec23ip A G 7: 128,776,784 Y774C probably damaging Het
Setdb2 T C 14: 59,419,118 D266G probably damaging Het
Shank1 T C 7: 44,352,886 V1343A probably benign Het
Slf2 T A 19: 44,973,235 D1064E probably benign Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Smg1 A T 7: 118,154,664 probably benign Het
Sptlc2 A T 12: 87,346,761 L264Q probably damaging Het
Sra1 A G 18: 36,678,407 S93P probably damaging Het
Sult1c1 T C 17: 53,964,652 E169G probably benign Het
Sv2a A G 3: 96,185,572 D196G probably damaging Het
Tbc1d22b A G 17: 29,594,780 I362M probably damaging Het
Tenm3 T C 8: 48,228,762 D2611G probably damaging Het
Tmem43 T C 6: 91,480,708 F191L probably benign Het
Trbv13-2 T A 6: 41,121,694 Y68N probably benign Het
Ttn T G 2: 76,774,654 D18312A possibly damaging Het
Ublcp1 A G 11: 44,465,606 V95A probably damaging Het
Usp17ld A G 7: 103,250,840 V295A probably damaging Het
Vmn1r29 T A 6: 58,308,167 L291M possibly damaging Het
Vsig10l C T 7: 43,464,151 R176* probably null Het
Zbtb46 A G 2: 181,423,417 probably null Het
Zfp644 A G 5: 106,637,982 V233A probably benign Het
Other mutations in Mbd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Mbd6 APN 10 127284119 unclassified probably benign
IGL01685:Mbd6 APN 10 127284732 unclassified probably benign
IGL02741:Mbd6 APN 10 127287394 critical splice donor site probably null
IGL03090:Mbd6 APN 10 127287144 missense probably damaging 1.00
IGL03395:Mbd6 APN 10 127283417 missense probably damaging 1.00
R0041:Mbd6 UTSW 10 127286872 missense probably damaging 1.00
R0480:Mbd6 UTSW 10 127285873 unclassified probably benign
R0507:Mbd6 UTSW 10 127283520 unclassified probably benign
R1686:Mbd6 UTSW 10 127287417 missense probably damaging 0.99
R3418:Mbd6 UTSW 10 127286503 missense probably null 0.83
R3419:Mbd6 UTSW 10 127286503 missense probably null 0.83
R3724:Mbd6 UTSW 10 127283891 unclassified probably benign
R3731:Mbd6 UTSW 10 127285768 unclassified probably benign
R3742:Mbd6 UTSW 10 127284943 unclassified probably benign
R3800:Mbd6 UTSW 10 127285167 unclassified probably benign
R5023:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5024:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5053:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5056:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5568:Mbd6 UTSW 10 127283428 missense possibly damaging 0.82
R7607:Mbd6 UTSW 10 127285230 missense unknown
Predicted Primers PCR Primer
(F):5'- CACCAAATAAACTGTGGCTAAGG -3'
(R):5'- TCAGCCTTACAGCCATCCAG -3'

Sequencing Primer
(F):5'- CCAAATAAACTGTGGCTAAGGAATGG -3'
(R):5'- GGGGTAGTTTGGAGAGCACTC -3'
Posted On2016-11-09