Incidental Mutation 'R5656:Olfr397'
ID442344
Institutional Source Beutler Lab
Gene Symbol Olfr397
Ensembl Gene ENSMUSG00000057050
Gene Nameolfactory receptor 397
SynonymsGA_x6K02T2P1NL-4121434-4122381, MOR135-28
MMRRC Submission 043302-MU
Accession Numbers

Genbank: NM_146346; MGI: 3030231

Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5656 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73960817-73967812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73964710 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 34 (M34K)
Ref Sequence ENSEMBL: ENSMUSP00000150172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108465] [ENSMUST00000121280] [ENSMUST00000213134] [ENSMUST00000216291]
Predicted Effect probably damaging
Transcript: ENSMUST00000108465
AA Change: M34K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104105
Gene: ENSMUSG00000062128
AA Change: M34K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.9e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.8e-8 PFAM
Pfam:7tm_1 41 290 1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121280
AA Change: M34K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113870
Gene: ENSMUSG00000057050
AA Change: M34K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 305 1.3e-6 PFAM
Pfam:7tm_1 41 290 4.3e-35 PFAM
Pfam:7tm_4 139 283 1.2e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213134
AA Change: M34K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215020
Predicted Effect probably damaging
Transcript: ENSMUST00000216291
AA Change: M34K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Adrb3 T C 8: 27,227,377 D348G probably damaging Het
Atg2b A G 12: 105,621,328 V1959A probably benign Het
Bicral G A 17: 46,808,369 T742M probably damaging Het
Bub1b T A 2: 118,605,431 I60N probably damaging Het
Ccdc162 A G 10: 41,569,934 V414A probably benign Het
Cd22 T G 7: 30,869,773 Y612S probably damaging Het
Cd68 T A 11: 69,664,421 I320F probably damaging Het
Clca3a2 A T 3: 144,797,632 N852K probably benign Het
Cpa6 T A 1: 10,329,514 H363L probably benign Het
Ddx18 A T 1: 121,561,358 L320Q probably damaging Het
Dnah5 A G 15: 28,421,064 D3849G probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Efs T C 14: 54,917,127 T552A probably damaging Het
Fbp1 C A 13: 62,875,196 V96L probably damaging Het
Gtf3c1 T A 7: 125,662,654 N1139I probably benign Het
Gucy1b2 T C 14: 62,422,981 Y152C probably damaging Het
Gxylt1 A T 15: 93,245,661 L362Q probably damaging Het
Iqcd A G 5: 120,605,126 probably null Het
Klhl41 T A 2: 69,683,532 I585N possibly damaging Het
Map6 A G 7: 99,336,298 K470E probably damaging Het
Mast3 T C 8: 70,786,221 T496A probably damaging Het
Mbd6 A T 10: 127,285,286 probably benign Het
Melk A G 4: 44,312,237 K183R possibly damaging Het
Mta1 T C 12: 113,123,139 V152A probably damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Nav3 A C 10: 109,764,633 S1378A probably damaging Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Nlrp4f G A 13: 65,190,871 R651* probably null Het
Olfr1480 A G 19: 13,530,380 T280A probably benign Het
Olfr497 A G 7: 108,422,618 I16V probably benign Het
P2rx7 A T 5: 122,673,717 R364W probably damaging Het
Phactr2 T C 10: 13,388,703 D2G probably benign Het
Phc3 G T 3: 30,965,866 S28R probably damaging Het
Ppfia1 A T 7: 144,519,974 probably null Het
Prdm10 C T 9: 31,353,417 T667M probably benign Het
Pwwp2b T A 7: 139,255,971 S443T possibly damaging Het
Pzp T C 6: 128,490,072 T1113A probably damaging Het
Rapgef6 A G 11: 54,636,136 E551G possibly damaging Het
Sec23ip A G 7: 128,776,784 Y774C probably damaging Het
Setdb2 T C 14: 59,419,118 D266G probably damaging Het
Shank1 T C 7: 44,352,886 V1343A probably benign Het
Slf2 T A 19: 44,973,235 D1064E probably benign Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Smg1 A T 7: 118,154,664 probably benign Het
Sptlc2 A T 12: 87,346,761 L264Q probably damaging Het
Sra1 A G 18: 36,678,407 S93P probably damaging Het
Sult1c1 T C 17: 53,964,652 E169G probably benign Het
Sv2a A G 3: 96,185,572 D196G probably damaging Het
Tbc1d22b A G 17: 29,594,780 I362M probably damaging Het
Tenm3 T C 8: 48,228,762 D2611G probably damaging Het
Tmem43 T C 6: 91,480,708 F191L probably benign Het
Trbv13-2 T A 6: 41,121,694 Y68N probably benign Het
Ttn T G 2: 76,774,654 D18312A possibly damaging Het
Ublcp1 A G 11: 44,465,606 V95A probably damaging Het
Usp17ld A G 7: 103,250,840 V295A probably damaging Het
Vmn1r29 T A 6: 58,308,167 L291M possibly damaging Het
Vsig10l C T 7: 43,464,151 R176* probably null Het
Zbtb46 A G 2: 181,423,417 probably null Het
Zfp644 A G 5: 106,637,982 V233A probably benign Het
Other mutations in Olfr397
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01797:Olfr397 APN 11 73964818 missense probably damaging 1.00
IGL01839:Olfr397 APN 11 73964611 start codon destroyed probably null 1.00
IGL02247:Olfr397 APN 11 73964862 missense probably benign 0.05
IGL02876:Olfr397 APN 11 73964713 missense possibly damaging 0.95
IGL03051:Olfr397 APN 11 73965034 missense probably benign 0.04
IGL03123:Olfr397 APN 11 73964986 missense probably damaging 1.00
IGL03401:Olfr397 APN 11 73965562 utr 3 prime probably benign
3-1:Olfr397 UTSW 11 73964977 missense possibly damaging 0.84
R0496:Olfr397 UTSW 11 73964880 missense probably benign 0.42
R0811:Olfr397 UTSW 11 73965420 missense probably benign 0.02
R0812:Olfr397 UTSW 11 73965420 missense probably benign 0.02
R1503:Olfr397 UTSW 11 73964568 utr 5 prime probably null
R2067:Olfr397 UTSW 11 73964914 missense probably damaging 1.00
R2111:Olfr397 UTSW 11 73964914 missense probably damaging 1.00
R4912:Olfr397 UTSW 11 73965340 missense probably damaging 1.00
R5240:Olfr397 UTSW 11 73964806 missense probably damaging 1.00
R5801:Olfr397 UTSW 11 73964946 missense probably benign 0.39
R6329:Olfr397 UTSW 11 73964742 missense possibly damaging 0.73
R6720:Olfr397 UTSW 11 73965465 missense probably damaging 1.00
R7149:Olfr397 UTSW 11 73965431 missense probably benign 0.01
R7283:Olfr397 UTSW 11 73964808 missense probably damaging 1.00
R8194:Olfr397 UTSW 11 73965414 missense probably benign 0.00
Z1176:Olfr397 UTSW 11 73965297 frame shift probably null
Z1177:Olfr397 UTSW 11 73964760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTCTTCCTAAAGCATTGGC -3'
(R):5'- ACATAGCGATCATAGGCCATGG -3'

Sequencing Primer
(F):5'- GCATTGGCTTTGTGTATGTTTATAC -3'
(R):5'- GTACATTTGTGCCAGGCAAC -3'
Posted On2016-11-09