Mutagenetix > Incidental Mutation

Incidental Mutation 'R5656:Atg2b'

442346

Institutional Source

Beutler Lab

Gene Symbol

Atg2b

Ensembl Gene

ENSMUSG00000041341

Gene Name

autophagy related 2B

Synonyms

MMRRC Submission

043302-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.199) question?

Stock #

R5656 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105616136-105685211 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 105621328 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1959 (V1959A)

Ref Sequence

ENSEMBL: ENSMUSP00000037441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041055]

AlphaFold

Q80XK6

Predicted Effect

probably benign
Transcript: ENSMUST00000041055
AA Change: V1959A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000037441
Gene: ENSMUSG00000041341
AA Change: V1959A

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	11	127	3.5e-19	PFAM
low complexity region	286	298	N/A	INTRINSIC
low complexity region	409	428	N/A	INTRINSIC
low complexity region	864	870	N/A	INTRINSIC
low complexity region	893	904	N/A	INTRINSIC
low complexity region	1722	1733	N/A	INTRINSIC
Pfam:ATG_C	1976	2071	1.4e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220960

Predicted Effect

unknown
Transcript: ENSMUST00000221015
AA Change: V799A

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222395

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein required for autophagy. The encoded protein is involved in autophagosome formation. A germline duplication of a region that includes this gene is associated with predisposition to myeloid malignancies. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	A	G	8: 105,709,512	S139G	probably benign	Het
Adrb3	T	C	8: 27,227,377	D348G	probably damaging	Het
Bicral	G	A	17: 46,808,369	T742M	probably damaging	Het
Bub1b	T	A	2: 118,605,431	I60N	probably damaging	Het
Ccdc162	A	G	10: 41,569,934	V414A	probably benign	Het
Cd22	T	G	7: 30,869,773	Y612S	probably damaging	Het
Cd68	T	A	11: 69,664,421	I320F	probably damaging	Het
Clca3a2	A	T	3: 144,797,632	N852K	probably benign	Het
Cpa6	T	A	1: 10,329,514	H363L	probably benign	Het
Ddx18	A	T	1: 121,561,358	L320Q	probably damaging	Het
Dnah5	A	G	15: 28,421,064	D3849G	probably benign	Het
Eci1	T	A	17: 24,437,309	N164K	probably damaging	Het
Efs	T	C	14: 54,917,127	T552A	probably damaging	Het
Fbp1	C	A	13: 62,875,196	V96L	probably damaging	Het
Gtf3c1	T	A	7: 125,662,654	N1139I	probably benign	Het
Gucy1b2	T	C	14: 62,422,981	Y152C	probably damaging	Het
Gxylt1	A	T	15: 93,245,661	L362Q	probably damaging	Het
Iqcd	A	G	5: 120,605,126		probably null	Het
Klhl41	T	A	2: 69,683,532	I585N	possibly damaging	Het
Map6	A	G	7: 99,336,298	K470E	probably damaging	Het
Mast3	T	C	8: 70,786,221	T496A	probably damaging	Het
Mbd6	A	T	10: 127,285,286		probably benign	Het
Melk	A	G	4: 44,312,237	K183R	possibly damaging	Het
Mta1	T	C	12: 113,123,139	V152A	probably damaging	Het
Naa35	G	A	13: 59,622,866		probably benign	Het
Nav3	A	C	10: 109,764,633	S1378A	probably damaging	Het
Ncapd3	T	A	9: 27,051,645	D415E	possibly damaging	Het
Nlrp4f	G	A	13: 65,190,871	R651*	probably null	Het
Olfr1480	A	G	19: 13,530,380	T280A	probably benign	Het
Olfr397	T	A	11: 73,964,710	M34K	probably damaging	Het
Olfr497	A	G	7: 108,422,618	I16V	probably benign	Het
P2rx7	A	T	5: 122,673,717	R364W	probably damaging	Het
Phactr2	T	C	10: 13,388,703	D2G	probably benign	Het
Phc3	G	T	3: 30,965,866	S28R	probably damaging	Het
Ppfia1	A	T	7: 144,519,974		probably null	Het
Prdm10	C	T	9: 31,353,417	T667M	probably benign	Het
Pwwp2b	T	A	7: 139,255,971	S443T	possibly damaging	Het
Pzp	T	C	6: 128,490,072	T1113A	probably damaging	Het
Rapgef6	A	G	11: 54,636,136	E551G	possibly damaging	Het
Sec23ip	A	G	7: 128,776,784	Y774C	probably damaging	Het
Setdb2	T	C	14: 59,419,118	D266G	probably damaging	Het
Shank1	T	C	7: 44,352,886	V1343A	probably benign	Het
Slf2	T	A	19: 44,973,235	D1064E	probably benign	Het
Slu7	A	G	11: 43,443,418	K424E	probably benign	Het
Smg1	A	T	7: 118,154,664		probably benign	Het
Sptlc2	A	T	12: 87,346,761	L264Q	probably damaging	Het
Sra1	A	G	18: 36,678,407	S93P	probably damaging	Het
Sult1c1	T	C	17: 53,964,652	E169G	probably benign	Het
Sv2a	A	G	3: 96,185,572	D196G	probably damaging	Het
Tbc1d22b	A	G	17: 29,594,780	I362M	probably damaging	Het
Tenm3	T	C	8: 48,228,762	D2611G	probably damaging	Het
Tmem43	T	C	6: 91,480,708	F191L	probably benign	Het
Trbv13-2	T	A	6: 41,121,694	Y68N	probably benign	Het
Ttn	T	G	2: 76,774,654	D18312A	possibly damaging	Het
Ublcp1	A	G	11: 44,465,606	V95A	probably damaging	Het
Usp17ld	A	G	7: 103,250,840	V295A	probably damaging	Het
Vmn1r29	T	A	6: 58,308,167	L291M	possibly damaging	Het
Vsig10l	C	T	7: 43,464,151	R176*	probably null	Het
Zbtb46	A	G	2: 181,423,417		probably null	Het
Zfp644	A	G	5: 106,637,982	V233A	probably benign	Het

Other mutations in Atg2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Atg2b	APN	12	105644916	missense	probably benign	0.20
IGL01326:Atg2b	APN	12	105622144	missense	probably damaging	1.00
IGL02063:Atg2b	APN	12	105648322	missense	possibly damaging	0.89
IGL02260:Atg2b	APN	12	105636440	splice site	probably benign
IGL02376:Atg2b	APN	12	105645468	missense	probably damaging	1.00
IGL02381:Atg2b	APN	12	105648348	missense	probably damaging	1.00
IGL02434:Atg2b	APN	12	105639207	missense	probably benign	0.00
IGL02534:Atg2b	APN	12	105643267	missense	probably damaging	1.00
IGL03011:Atg2b	APN	12	105626362	missense	probably damaging	0.98
IGL03173:Atg2b	APN	12	105658294	missense	possibly damaging	0.68
R6669_atg2b_067	UTSW	12	105671529	missense	possibly damaging	0.90
rail	UTSW	12	105658840	nonsense	probably null
Sora	UTSW	12	105623430	missense	probably benign	0.06
R0066:Atg2b	UTSW	12	105648449	missense	probably benign
R0066:Atg2b	UTSW	12	105648449	missense	probably benign
R0511:Atg2b	UTSW	12	105617153	missense	probably damaging	1.00
R0762:Atg2b	UTSW	12	105674970	missense	possibly damaging	0.56
R0786:Atg2b	UTSW	12	105636508	missense	probably benign	0.00
R1029:Atg2b	UTSW	12	105635773	missense	probably damaging	0.96
R1529:Atg2b	UTSW	12	105661133	missense	probably benign
R1563:Atg2b	UTSW	12	105623488	missense	probably damaging	0.99
R1746:Atg2b	UTSW	12	105669329	missense	possibly damaging	0.79
R1887:Atg2b	UTSW	12	105654092	missense	probably benign	0.01
R1956:Atg2b	UTSW	12	105669418	missense	probably damaging	1.00
R1957:Atg2b	UTSW	12	105669418	missense	probably damaging	1.00
R2272:Atg2b	UTSW	12	105638008	missense	probably benign	0.00
R2877:Atg2b	UTSW	12	105664009	nonsense	probably null
R2878:Atg2b	UTSW	12	105664009	nonsense	probably null
R4798:Atg2b	UTSW	12	105652629	missense	probably benign	0.37
R4836:Atg2b	UTSW	12	105646814	missense	probably benign
R5007:Atg2b	UTSW	12	105643876	splice site	probably null
R5042:Atg2b	UTSW	12	105621262	missense	probably benign	0.01
R5134:Atg2b	UTSW	12	105674950	missense	probably damaging	0.96
R5212:Atg2b	UTSW	12	105646796	missense	probably benign	0.00
R5250:Atg2b	UTSW	12	105635765	missense	probably damaging	1.00
R5307:Atg2b	UTSW	12	105658329	missense	probably benign	0.17
R5342:Atg2b	UTSW	12	105658916	missense	possibly damaging	0.90
R5583:Atg2b	UTSW	12	105649155	missense	possibly damaging	0.94
R5660:Atg2b	UTSW	12	105649124	nonsense	probably null
R5903:Atg2b	UTSW	12	105639359	missense	possibly damaging	0.90
R6018:Atg2b	UTSW	12	105661171	missense	probably damaging	0.96
R6153:Atg2b	UTSW	12	105623482	missense	possibly damaging	0.80
R6326:Atg2b	UTSW	12	105661092	nonsense	probably null
R6584:Atg2b	UTSW	12	105657995	missense	probably damaging	1.00
R6593:Atg2b	UTSW	12	105644848	missense	probably damaging	1.00
R6669:Atg2b	UTSW	12	105671529	missense	possibly damaging	0.90
R6847:Atg2b	UTSW	12	105635788	missense	probably damaging	1.00
R7003:Atg2b	UTSW	12	105654249	missense	probably benign	0.01
R7193:Atg2b	UTSW	12	105664708	missense	probably damaging	1.00
R7387:Atg2b	UTSW	12	105622775	missense	probably damaging	1.00
R7432:Atg2b	UTSW	12	105661204	missense	probably damaging	0.98
R7432:Atg2b	UTSW	12	105664698	missense	probably benign	0.08
R7630:Atg2b	UTSW	12	105646954	critical splice acceptor site	probably null
R7634:Atg2b	UTSW	12	105652120	missense	probably damaging	1.00
R7645:Atg2b	UTSW	12	105623430	missense	probably benign	0.06
R7653:Atg2b	UTSW	12	105636472	missense	possibly damaging	0.68
R8157:Atg2b	UTSW	12	105662940	missense	probably damaging	1.00
R8222:Atg2b	UTSW	12	105652216	missense	possibly damaging	0.95
R8469:Atg2b	UTSW	12	105637911	missense	probably benign	0.00
R8708:Atg2b	UTSW	12	105669428	critical splice acceptor site	probably benign
R8784:Atg2b	UTSW	12	105639241	missense	probably damaging	1.00
R8975:Atg2b	UTSW	12	105636466	missense	probably damaging	1.00
R8988:Atg2b	UTSW	12	105617129	missense	probably damaging	0.97
R9071:Atg2b	UTSW	12	105658840	nonsense	probably null
R9269:Atg2b	UTSW	12	105652100	missense	probably damaging	1.00
R9355:Atg2b	UTSW	12	105670721	missense	possibly damaging	0.48
R9402:Atg2b	UTSW	12	105648423	missense	probably damaging	0.98
R9492:Atg2b	UTSW	12	105658290	missense	probably benign	0.06
X0018:Atg2b	UTSW	12	105666697	missense	possibly damaging	0.86
X0066:Atg2b	UTSW	12	105646785	missense	probably benign	0.12
Z1177:Atg2b	UTSW	12	105635764	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAGTCAGTGAAGTCTGCGGG -3'
(R):5'- TCTGAGTGTTGAAGCAGAGG -3'

Sequencing Primer
(F):5'- CCTCACTGATGGACTGCAATGTG -3'
(R):5'- CAGAGGCACTGTGTGTGTG -3'

Posted On

2016-11-09