Incidental Mutation 'R5656:Efs'
ID 442350
Institutional Source Beutler Lab
Gene Symbol Efs
Ensembl Gene ENSMUSG00000022203
Gene Name embryonal Fyn-associated substrate
Synonyms
MMRRC Submission 043302-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.137) question?
Stock # R5656 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 55153992-55163583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55154584 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 552 (T552A)
Ref Sequence ENSEMBL: ENSMUSP00000022813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022813] [ENSMUST00000050772] [ENSMUST00000227037] [ENSMUST00000227587] [ENSMUST00000231305] [ENSMUST00000227880] [ENSMUST00000228119] [ENSMUST00000228495] [ENSMUST00000228588]
AlphaFold Q64355
Predicted Effect probably damaging
Transcript: ENSMUST00000022813
AA Change: T552A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022813
Gene: ENSMUSG00000022203
AA Change: T552A

DomainStartEndE-ValueType
SH3 8 67 5.15e-19 SMART
low complexity region 201 215 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 305 325 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Pfam:DUF3513 370 555 9.2e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050772
SMART Domains Protein: ENSMUSP00000049676
Gene: ENSMUSG00000022199

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 370 1.8e-17 PFAM
Pfam:MFS_1 211 394 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226718
Predicted Effect probably damaging
Transcript: ENSMUST00000227037
AA Change: T459A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000227587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227600
Predicted Effect probably benign
Transcript: ENSMUST00000231305
Predicted Effect probably benign
Transcript: ENSMUST00000227880
Predicted Effect probably benign
Transcript: ENSMUST00000228119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228249
Predicted Effect probably benign
Transcript: ENSMUST00000228495
Predicted Effect probably benign
Transcript: ENSMUST00000228588
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The longest protein isoform encoded by this gene contains an SH3 domain, which is known to be important in intracellular signal transduction. The protein encoded by a similiar gene in mice was shown to bind to SH3 domains of protein-tyrosine kinases. The function of this gene is unknown. Three alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display an increased inflammatory response characterized by excessive T cell responses, enhanced cytokine secretion and antibody production, and intestinal, kidney, liver, and lung inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 106,436,144 (GRCm39) S139G probably benign Het
Adrb3 T C 8: 27,717,405 (GRCm39) D348G probably damaging Het
Atg2b A G 12: 105,587,587 (GRCm39) V1959A probably benign Het
Bicral G A 17: 47,119,295 (GRCm39) T742M probably damaging Het
Bub1b T A 2: 118,435,912 (GRCm39) I60N probably damaging Het
Ccdc162 A G 10: 41,445,930 (GRCm39) V414A probably benign Het
Cd22 T G 7: 30,569,198 (GRCm39) Y612S probably damaging Het
Cd68 T A 11: 69,555,247 (GRCm39) I320F probably damaging Het
Clca3a2 A T 3: 144,503,393 (GRCm39) N852K probably benign Het
Cpa6 T A 1: 10,399,739 (GRCm39) H363L probably benign Het
Ddx18 A T 1: 121,489,087 (GRCm39) L320Q probably damaging Het
Dnah5 A G 15: 28,421,210 (GRCm39) D3849G probably benign Het
Eci1 T A 17: 24,656,283 (GRCm39) N164K probably damaging Het
Fbp1 C A 13: 63,023,010 (GRCm39) V96L probably damaging Het
Gtf3c1 T A 7: 125,261,826 (GRCm39) N1139I probably benign Het
Gucy1b2 T C 14: 62,660,430 (GRCm39) Y152C probably damaging Het
Gxylt1 A T 15: 93,143,542 (GRCm39) L362Q probably damaging Het
Iqcd A G 5: 120,743,191 (GRCm39) probably null Het
Klhl41 T A 2: 69,513,876 (GRCm39) I585N possibly damaging Het
Map6 A G 7: 98,985,505 (GRCm39) K470E probably damaging Het
Mast3 T C 8: 71,238,865 (GRCm39) T496A probably damaging Het
Mbd6 A T 10: 127,121,155 (GRCm39) probably benign Het
Melk A G 4: 44,312,237 (GRCm39) K183R possibly damaging Het
Mta1 T C 12: 113,086,759 (GRCm39) V152A probably damaging Het
Naa35 G A 13: 59,770,680 (GRCm39) probably benign Het
Nav3 A C 10: 109,600,494 (GRCm39) S1378A probably damaging Het
Ncapd3 T A 9: 26,962,941 (GRCm39) D415E possibly damaging Het
Nlrp4f G A 13: 65,338,685 (GRCm39) R651* probably null Het
Or1e1f T A 11: 73,855,536 (GRCm39) M34K probably damaging Het
Or5b121 A G 19: 13,507,744 (GRCm39) T280A probably benign Het
Or5p72 A G 7: 108,021,825 (GRCm39) I16V probably benign Het
P2rx7 A T 5: 122,811,780 (GRCm39) R364W probably damaging Het
Phactr2 T C 10: 13,264,447 (GRCm39) D2G probably benign Het
Phc3 G T 3: 31,020,015 (GRCm39) S28R probably damaging Het
Ppfia1 A T 7: 144,073,711 (GRCm39) probably null Het
Prdm10 C T 9: 31,264,713 (GRCm39) T667M probably benign Het
Pwwp2b T A 7: 138,835,887 (GRCm39) S443T possibly damaging Het
Pzp T C 6: 128,467,035 (GRCm39) T1113A probably damaging Het
Rapgef6 A G 11: 54,526,962 (GRCm39) E551G possibly damaging Het
Sec23ip A G 7: 128,378,508 (GRCm39) Y774C probably damaging Het
Setdb2 T C 14: 59,656,567 (GRCm39) D266G probably damaging Het
Shank1 T C 7: 44,002,310 (GRCm39) V1343A probably benign Het
Slf2 T A 19: 44,961,674 (GRCm39) D1064E probably benign Het
Slu7 A G 11: 43,334,245 (GRCm39) K424E probably benign Het
Smg1 A T 7: 117,753,887 (GRCm39) probably benign Het
Sptlc2 A T 12: 87,393,535 (GRCm39) L264Q probably damaging Het
Sra1 A G 18: 36,811,460 (GRCm39) S93P probably damaging Het
Sult1c2 T C 17: 54,271,680 (GRCm39) E169G probably benign Het
Sv2a A G 3: 96,092,888 (GRCm39) D196G probably damaging Het
Tbc1d22b A G 17: 29,813,754 (GRCm39) I362M probably damaging Het
Tenm3 T C 8: 48,681,797 (GRCm39) D2611G probably damaging Het
Tmem43 T C 6: 91,457,690 (GRCm39) F191L probably benign Het
Trbv13-2 T A 6: 41,098,628 (GRCm39) Y68N probably benign Het
Ttn T G 2: 76,604,998 (GRCm39) D18312A possibly damaging Het
Ublcp1 A G 11: 44,356,433 (GRCm39) V95A probably damaging Het
Usp17ld A G 7: 102,900,047 (GRCm39) V295A probably damaging Het
Vmn1r29 T A 6: 58,285,152 (GRCm39) L291M possibly damaging Het
Vsig10l C T 7: 43,113,575 (GRCm39) R176* probably null Het
Zbtb46 A G 2: 181,065,210 (GRCm39) probably null Het
Zfp644 A G 5: 106,785,848 (GRCm39) V233A probably benign Het
Other mutations in Efs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Efs APN 14 55,158,499 (GRCm39) missense probably damaging 1.00
IGL02720:Efs APN 14 55,157,172 (GRCm39) missense probably damaging 1.00
IGL02752:Efs APN 14 55,154,880 (GRCm39) missense probably damaging 0.96
R0129:Efs UTSW 14 55,154,680 (GRCm39) missense probably damaging 1.00
R1522:Efs UTSW 14 55,157,172 (GRCm39) missense probably damaging 1.00
R1927:Efs UTSW 14 55,154,620 (GRCm39) missense possibly damaging 0.89
R2327:Efs UTSW 14 55,154,961 (GRCm39) missense probably benign 0.01
R3431:Efs UTSW 14 55,157,681 (GRCm39) missense probably damaging 1.00
R3432:Efs UTSW 14 55,157,681 (GRCm39) missense probably damaging 1.00
R3615:Efs UTSW 14 55,157,552 (GRCm39) missense probably damaging 1.00
R3616:Efs UTSW 14 55,157,552 (GRCm39) missense probably damaging 1.00
R3756:Efs UTSW 14 55,157,879 (GRCm39) splice site probably benign
R3945:Efs UTSW 14 55,158,108 (GRCm39) splice site probably benign
R4448:Efs UTSW 14 55,157,649 (GRCm39) missense probably damaging 1.00
R4717:Efs UTSW 14 55,157,801 (GRCm39) missense probably damaging 0.99
R4819:Efs UTSW 14 55,154,610 (GRCm39) missense probably damaging 0.98
R5946:Efs UTSW 14 55,156,951 (GRCm39) splice site probably null
R6054:Efs UTSW 14 55,158,614 (GRCm39) missense probably damaging 1.00
R7457:Efs UTSW 14 55,157,451 (GRCm39) missense probably benign
R7822:Efs UTSW 14 55,154,907 (GRCm39) missense probably benign 0.09
R7970:Efs UTSW 14 55,157,960 (GRCm39) critical splice donor site probably null
R8166:Efs UTSW 14 55,158,077 (GRCm39) missense probably damaging 1.00
R8347:Efs UTSW 14 55,157,241 (GRCm39) missense probably benign 0.28
R8896:Efs UTSW 14 55,157,756 (GRCm39) missense possibly damaging 0.80
R9438:Efs UTSW 14 55,156,868 (GRCm39) missense
R9703:Efs UTSW 14 55,156,871 (GRCm39) missense possibly damaging 0.88
X0028:Efs UTSW 14 55,158,078 (GRCm39) nonsense probably null
Z1176:Efs UTSW 14 55,157,793 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AACGAGGAGAATCCAGTCCCTC -3'
(R):5'- TTGTTGGAGACACCCTAGGC -3'

Sequencing Primer
(F):5'- TGATGCCTGCCTGGACAAAG -3'
(R):5'- ACACCCTAGGCCGGCTG -3'
Posted On 2016-11-09