Incidental Mutation 'R5656:Setdb2'
ID442351
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene NameSET domain, bifurcated 2
SynonymsKMT1F, LOC239122
MMRRC Submission 043302-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.587) question?
Stock #R5656 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location59402009-59440884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59419118 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 266 (D266G)
Ref Sequence ENSEMBL: ENSMUSP00000093450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000111253] [ENSMUST00000161459]
Predicted Effect probably damaging
Transcript: ENSMUST00000095775
AA Change: D266G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: D266G

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111253
Predicted Effect probably damaging
Transcript: ENSMUST00000161459
AA Change: D250G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: D250G

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161959
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Adrb3 T C 8: 27,227,377 D348G probably damaging Het
Atg2b A G 12: 105,621,328 V1959A probably benign Het
Bicral G A 17: 46,808,369 T742M probably damaging Het
Bub1b T A 2: 118,605,431 I60N probably damaging Het
Ccdc162 A G 10: 41,569,934 V414A probably benign Het
Cd22 T G 7: 30,869,773 Y612S probably damaging Het
Cd68 T A 11: 69,664,421 I320F probably damaging Het
Clca3a2 A T 3: 144,797,632 N852K probably benign Het
Cpa6 T A 1: 10,329,514 H363L probably benign Het
Ddx18 A T 1: 121,561,358 L320Q probably damaging Het
Dnah5 A G 15: 28,421,064 D3849G probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Efs T C 14: 54,917,127 T552A probably damaging Het
Fbp1 C A 13: 62,875,196 V96L probably damaging Het
Gtf3c1 T A 7: 125,662,654 N1139I probably benign Het
Gucy1b2 T C 14: 62,422,981 Y152C probably damaging Het
Gxylt1 A T 15: 93,245,661 L362Q probably damaging Het
Iqcd A G 5: 120,605,126 probably null Het
Klhl41 T A 2: 69,683,532 I585N possibly damaging Het
Map6 A G 7: 99,336,298 K470E probably damaging Het
Mast3 T C 8: 70,786,221 T496A probably damaging Het
Mbd6 A T 10: 127,285,286 probably benign Het
Melk A G 4: 44,312,237 K183R possibly damaging Het
Mta1 T C 12: 113,123,139 V152A probably damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Nav3 A C 10: 109,764,633 S1378A probably damaging Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Nlrp4f G A 13: 65,190,871 R651* probably null Het
Olfr1480 A G 19: 13,530,380 T280A probably benign Het
Olfr397 T A 11: 73,964,710 M34K probably damaging Het
Olfr497 A G 7: 108,422,618 I16V probably benign Het
P2rx7 A T 5: 122,673,717 R364W probably damaging Het
Phactr2 T C 10: 13,388,703 D2G probably benign Het
Phc3 G T 3: 30,965,866 S28R probably damaging Het
Ppfia1 A T 7: 144,519,974 probably null Het
Prdm10 C T 9: 31,353,417 T667M probably benign Het
Pwwp2b T A 7: 139,255,971 S443T possibly damaging Het
Pzp T C 6: 128,490,072 T1113A probably damaging Het
Rapgef6 A G 11: 54,636,136 E551G possibly damaging Het
Sec23ip A G 7: 128,776,784 Y774C probably damaging Het
Shank1 T C 7: 44,352,886 V1343A probably benign Het
Slf2 T A 19: 44,973,235 D1064E probably benign Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Smg1 A T 7: 118,154,664 probably benign Het
Sptlc2 A T 12: 87,346,761 L264Q probably damaging Het
Sra1 A G 18: 36,678,407 S93P probably damaging Het
Sult1c1 T C 17: 53,964,652 E169G probably benign Het
Sv2a A G 3: 96,185,572 D196G probably damaging Het
Tbc1d22b A G 17: 29,594,780 I362M probably damaging Het
Tenm3 T C 8: 48,228,762 D2611G probably damaging Het
Tmem43 T C 6: 91,480,708 F191L probably benign Het
Trbv13-2 T A 6: 41,121,694 Y68N probably benign Het
Ttn T G 2: 76,774,654 D18312A possibly damaging Het
Ublcp1 A G 11: 44,465,606 V95A probably damaging Het
Usp17ld A G 7: 103,250,840 V295A probably damaging Het
Vmn1r29 T A 6: 58,308,167 L291M possibly damaging Het
Vsig10l C T 7: 43,464,151 R176* probably null Het
Zbtb46 A G 2: 181,423,417 probably null Het
Zfp644 A G 5: 106,637,982 V233A probably benign Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59415792 missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59402293 utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59423436 missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59413490 missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59431158 missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59402315 missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59406744 splice site probably null
R0610:Setdb2 UTSW 14 59417470 missense possibly damaging 0.55
R0636:Setdb2 UTSW 14 59406704 missense probably benign 0.40
R0890:Setdb2 UTSW 14 59419220 missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59423496 splice site probably benign
R1355:Setdb2 UTSW 14 59417441 missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59417485 missense probably benign 0.04
R1968:Setdb2 UTSW 14 59419409 missense probably damaging 1.00
R2472:Setdb2 UTSW 14 59419454 missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59426467 missense probably benign 0.00
R3919:Setdb2 UTSW 14 59419167 missense probably damaging 1.00
R4609:Setdb2 UTSW 14 59415704 missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59409359 missense probably benign 0.13
R4816:Setdb2 UTSW 14 59413646 missense probably benign 0.05
R4864:Setdb2 UTSW 14 59409266 missense probably benign 0.01
R4951:Setdb2 UTSW 14 59402303 missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59415707 missense probably damaging 0.99
R5245:Setdb2 UTSW 14 59426494 missense probably null 0.00
R5358:Setdb2 UTSW 14 59409436 missense probably benign 0.17
R5705:Setdb2 UTSW 14 59423365 missense possibly damaging 0.80
R6103:Setdb2 UTSW 14 59409532 splice site probably null
R6106:Setdb2 UTSW 14 59423449 nonsense probably null
R6388:Setdb2 UTSW 14 59424697 missense probably benign
R6431:Setdb2 UTSW 14 59419056 missense probably damaging 1.00
R6494:Setdb2 UTSW 14 59402414 missense probably benign 0.12
R6971:Setdb2 UTSW 14 59415740 missense probably damaging 1.00
R7442:Setdb2 UTSW 14 59419251 missense probably damaging 0.99
R7444:Setdb2 UTSW 14 59423345 nonsense probably null
R7759:Setdb2 UTSW 14 59419364 missense probably damaging 1.00
R8021:Setdb2 UTSW 14 59423384 nonsense probably null
R8039:Setdb2 UTSW 14 59402375 missense probably damaging 1.00
X0017:Setdb2 UTSW 14 59419468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGTAGGACGAAGCAAATATGTC -3'
(R):5'- TTATAAAACGCCCTGTGGACG -3'

Sequencing Primer
(F):5'- GACGAAGCAAATATGTCTACATGC -3'
(R):5'- CCTGTGGACGGAATCTACGAAAC -3'
Posted On2016-11-09