Incidental Mutation 'R5656:Gucy1b2'
ID 442352
Institutional Source Beutler Lab
Gene Symbol Gucy1b2
Ensembl Gene ENSMUSG00000021933
Gene Name guanylate cyclase 1, soluble, beta 2
Synonyms
MMRRC Submission 043302-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock # R5656 (G1)
Quality Score 224
Status Not validated
Chromosome 14
Chromosomal Location 62392676-62456289 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 62422981 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 152 (Y152C)
Ref Sequence ENSEMBL: ENSMUSP00000128114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022501] [ENSMUST00000128573] [ENSMUST00000165651]
AlphaFold Q8BXH3
Predicted Effect probably damaging
Transcript: ENSMUST00000022501
AA Change: Y152C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022501
Gene: ENSMUSG00000021933
AA Change: Y152C

DomainStartEndE-ValueType
Pfam:HNOB 83 244 6e-60 PFAM
Blast:CYCc 263 362 3e-24 BLAST
PDB:4GJ4|D 350 471 4e-8 PDB
CYCc 513 712 1.11e-108 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128573
SMART Domains Protein: ENSMUSP00000120329
Gene: ENSMUSG00000021933

DomainStartEndE-ValueType
Pfam:HNOB 1 167 1.5e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165651
AA Change: Y152C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128114
Gene: ENSMUSG00000021933
AA Change: Y152C

DomainStartEndE-ValueType
Pfam:HNOB 82 250 1.1e-53 PFAM
Blast:CYCc 263 347 6e-25 BLAST
PDB:4GJ4|D 335 456 5e-8 PDB
CYCc 498 697 1.11e-108 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal hyperventilation response to a 10% oxygen environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Adrb3 T C 8: 27,227,377 D348G probably damaging Het
Atg2b A G 12: 105,621,328 V1959A probably benign Het
Bicral G A 17: 46,808,369 T742M probably damaging Het
Bub1b T A 2: 118,605,431 I60N probably damaging Het
Ccdc162 A G 10: 41,569,934 V414A probably benign Het
Cd22 T G 7: 30,869,773 Y612S probably damaging Het
Cd68 T A 11: 69,664,421 I320F probably damaging Het
Clca3a2 A T 3: 144,797,632 N852K probably benign Het
Cpa6 T A 1: 10,329,514 H363L probably benign Het
Ddx18 A T 1: 121,561,358 L320Q probably damaging Het
Dnah5 A G 15: 28,421,064 D3849G probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Efs T C 14: 54,917,127 T552A probably damaging Het
Fbp1 C A 13: 62,875,196 V96L probably damaging Het
Gtf3c1 T A 7: 125,662,654 N1139I probably benign Het
Gxylt1 A T 15: 93,245,661 L362Q probably damaging Het
Iqcd A G 5: 120,605,126 probably null Het
Klhl41 T A 2: 69,683,532 I585N possibly damaging Het
Map6 A G 7: 99,336,298 K470E probably damaging Het
Mast3 T C 8: 70,786,221 T496A probably damaging Het
Mbd6 A T 10: 127,285,286 probably benign Het
Melk A G 4: 44,312,237 K183R possibly damaging Het
Mta1 T C 12: 113,123,139 V152A probably damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Nav3 A C 10: 109,764,633 S1378A probably damaging Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Nlrp4f G A 13: 65,190,871 R651* probably null Het
Olfr1480 A G 19: 13,530,380 T280A probably benign Het
Olfr397 T A 11: 73,964,710 M34K probably damaging Het
Olfr497 A G 7: 108,422,618 I16V probably benign Het
P2rx7 A T 5: 122,673,717 R364W probably damaging Het
Phactr2 T C 10: 13,388,703 D2G probably benign Het
Phc3 G T 3: 30,965,866 S28R probably damaging Het
Ppfia1 A T 7: 144,519,974 probably null Het
Prdm10 C T 9: 31,353,417 T667M probably benign Het
Pwwp2b T A 7: 139,255,971 S443T possibly damaging Het
Pzp T C 6: 128,490,072 T1113A probably damaging Het
Rapgef6 A G 11: 54,636,136 E551G possibly damaging Het
Sec23ip A G 7: 128,776,784 Y774C probably damaging Het
Setdb2 T C 14: 59,419,118 D266G probably damaging Het
Shank1 T C 7: 44,352,886 V1343A probably benign Het
Slf2 T A 19: 44,973,235 D1064E probably benign Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Smg1 A T 7: 118,154,664 probably benign Het
Sptlc2 A T 12: 87,346,761 L264Q probably damaging Het
Sra1 A G 18: 36,678,407 S93P probably damaging Het
Sult1c1 T C 17: 53,964,652 E169G probably benign Het
Sv2a A G 3: 96,185,572 D196G probably damaging Het
Tbc1d22b A G 17: 29,594,780 I362M probably damaging Het
Tenm3 T C 8: 48,228,762 D2611G probably damaging Het
Tmem43 T C 6: 91,480,708 F191L probably benign Het
Trbv13-2 T A 6: 41,121,694 Y68N probably benign Het
Ttn T G 2: 76,774,654 D18312A possibly damaging Het
Ublcp1 A G 11: 44,465,606 V95A probably damaging Het
Usp17ld A G 7: 103,250,840 V295A probably damaging Het
Vmn1r29 T A 6: 58,308,167 L291M possibly damaging Het
Vsig10l C T 7: 43,464,151 R176* probably null Het
Zbtb46 A G 2: 181,423,417 probably null Het
Zfp644 A G 5: 106,637,982 V233A probably benign Het
Other mutations in Gucy1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Gucy1b2 APN 14 62406245 missense probably damaging 1.00
IGL00465:Gucy1b2 APN 14 62403200 missense probably benign
IGL00756:Gucy1b2 APN 14 62403209 missense probably benign
IGL01800:Gucy1b2 APN 14 62411655 missense probably benign 0.03
IGL01875:Gucy1b2 APN 14 62420146 missense probably damaging 1.00
IGL03033:Gucy1b2 APN 14 62415944 missense probably benign 0.00
IGL03110:Gucy1b2 APN 14 62433834 splice site probably benign
IGL02796:Gucy1b2 UTSW 14 62407694 missense probably benign 0.42
R0183:Gucy1b2 UTSW 14 62419140 missense probably damaging 1.00
R0605:Gucy1b2 UTSW 14 62403159 splice site probably benign
R0815:Gucy1b2 UTSW 14 62419062 missense probably benign 0.00
R0863:Gucy1b2 UTSW 14 62419062 missense probably benign 0.00
R0972:Gucy1b2 UTSW 14 62408678 missense possibly damaging 0.88
R0972:Gucy1b2 UTSW 14 62414369 missense possibly damaging 0.61
R1438:Gucy1b2 UTSW 14 62414321 missense probably damaging 0.98
R2011:Gucy1b2 UTSW 14 62408758 missense probably damaging 0.99
R2409:Gucy1b2 UTSW 14 62406179 frame shift probably null
R3692:Gucy1b2 UTSW 14 62404627 missense probably damaging 1.00
R4484:Gucy1b2 UTSW 14 62411589 missense possibly damaging 0.88
R4715:Gucy1b2 UTSW 14 62423017 missense possibly damaging 0.95
R4730:Gucy1b2 UTSW 14 62407759 missense probably damaging 1.00
R4812:Gucy1b2 UTSW 14 62415897 splice site probably null
R4839:Gucy1b2 UTSW 14 62448246 missense probably damaging 1.00
R5261:Gucy1b2 UTSW 14 62404579 missense probably damaging 1.00
R5326:Gucy1b2 UTSW 14 62453330 critical splice donor site probably null
R5779:Gucy1b2 UTSW 14 62414301 missense possibly damaging 0.82
R6000:Gucy1b2 UTSW 14 62419050 missense probably benign 0.00
R6274:Gucy1b2 UTSW 14 62415939 missense probably damaging 1.00
R7457:Gucy1b2 UTSW 14 62392952 missense probably benign 0.08
R7487:Gucy1b2 UTSW 14 62448223 missense probably damaging 0.97
R7607:Gucy1b2 UTSW 14 62419177 missense probably damaging 1.00
R8030:Gucy1b2 UTSW 14 62392870 missense probably benign
R8285:Gucy1b2 UTSW 14 62420107 missense probably damaging 0.98
R8287:Gucy1b2 UTSW 14 62411816 missense probably damaging 1.00
R8970:Gucy1b2 UTSW 14 62419215 missense possibly damaging 0.95
RF030:Gucy1b2 UTSW 14 62408641 critical splice donor site probably benign
RF035:Gucy1b2 UTSW 14 62408641 critical splice donor site probably benign
Z1177:Gucy1b2 UTSW 14 62453453 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTTCCCCTAAGAGAGCTCCTGG -3'
(R):5'- CGTGTCACTGATGAGGAAAGTG -3'

Sequencing Primer
(F):5'- ACAGGTTGTGCAGCTCCTCTG -3'
(R):5'- GAAGAATTAGAAGGTCAGCAAGTATC -3'
Posted On 2016-11-09