Incidental Mutation 'R5656:Bicral'
ID442358
Institutional Source Beutler Lab
Gene Symbol Bicral
Ensembl Gene ENSMUSG00000036568
Gene NameBRD4 interacting chromatin remodeling complex associated protein like
SynonymsBC032203, Gltscr1l
MMRRC Submission 043302-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5656 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46798116-46831413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46808369 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 742 (T742M)
Ref Sequence ENSEMBL: ENSMUSP00000044833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040624]
Predicted Effect probably damaging
Transcript: ENSMUST00000040624
AA Change: T742M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044833
Gene: ENSMUSG00000036568
AA Change: T742M

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
low complexity region 605 616 N/A INTRINSIC
Pfam:GLTSCR1 701 808 4.5e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display abnormal embryo turning, embryonic growth retardation, cardiac hypertrophy, and complete embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Adrb3 T C 8: 27,227,377 D348G probably damaging Het
Atg2b A G 12: 105,621,328 V1959A probably benign Het
Bub1b T A 2: 118,605,431 I60N probably damaging Het
Ccdc162 A G 10: 41,569,934 V414A probably benign Het
Cd22 T G 7: 30,869,773 Y612S probably damaging Het
Cd68 T A 11: 69,664,421 I320F probably damaging Het
Clca3a2 A T 3: 144,797,632 N852K probably benign Het
Cpa6 T A 1: 10,329,514 H363L probably benign Het
Ddx18 A T 1: 121,561,358 L320Q probably damaging Het
Dnah5 A G 15: 28,421,064 D3849G probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Efs T C 14: 54,917,127 T552A probably damaging Het
Fbp1 C A 13: 62,875,196 V96L probably damaging Het
Gtf3c1 T A 7: 125,662,654 N1139I probably benign Het
Gucy1b2 T C 14: 62,422,981 Y152C probably damaging Het
Gxylt1 A T 15: 93,245,661 L362Q probably damaging Het
Iqcd A G 5: 120,605,126 probably null Het
Klhl41 T A 2: 69,683,532 I585N possibly damaging Het
Map6 A G 7: 99,336,298 K470E probably damaging Het
Mast3 T C 8: 70,786,221 T496A probably damaging Het
Mbd6 A T 10: 127,285,286 probably benign Het
Melk A G 4: 44,312,237 K183R possibly damaging Het
Mta1 T C 12: 113,123,139 V152A probably damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Nav3 A C 10: 109,764,633 S1378A probably damaging Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Nlrp4f G A 13: 65,190,871 R651* probably null Het
Olfr1480 A G 19: 13,530,380 T280A probably benign Het
Olfr397 T A 11: 73,964,710 M34K probably damaging Het
Olfr497 A G 7: 108,422,618 I16V probably benign Het
P2rx7 A T 5: 122,673,717 R364W probably damaging Het
Phactr2 T C 10: 13,388,703 D2G probably benign Het
Phc3 G T 3: 30,965,866 S28R probably damaging Het
Ppfia1 A T 7: 144,519,974 probably null Het
Prdm10 C T 9: 31,353,417 T667M probably benign Het
Pwwp2b T A 7: 139,255,971 S443T possibly damaging Het
Pzp T C 6: 128,490,072 T1113A probably damaging Het
Rapgef6 A G 11: 54,636,136 E551G possibly damaging Het
Sec23ip A G 7: 128,776,784 Y774C probably damaging Het
Setdb2 T C 14: 59,419,118 D266G probably damaging Het
Shank1 T C 7: 44,352,886 V1343A probably benign Het
Slf2 T A 19: 44,973,235 D1064E probably benign Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Smg1 A T 7: 118,154,664 probably benign Het
Sptlc2 A T 12: 87,346,761 L264Q probably damaging Het
Sra1 A G 18: 36,678,407 S93P probably damaging Het
Sult1c1 T C 17: 53,964,652 E169G probably benign Het
Sv2a A G 3: 96,185,572 D196G probably damaging Het
Tbc1d22b A G 17: 29,594,780 I362M probably damaging Het
Tenm3 T C 8: 48,228,762 D2611G probably damaging Het
Tmem43 T C 6: 91,480,708 F191L probably benign Het
Trbv13-2 T A 6: 41,121,694 Y68N probably benign Het
Ttn T G 2: 76,774,654 D18312A possibly damaging Het
Ublcp1 A G 11: 44,465,606 V95A probably damaging Het
Usp17ld A G 7: 103,250,840 V295A probably damaging Het
Vmn1r29 T A 6: 58,308,167 L291M possibly damaging Het
Vsig10l C T 7: 43,464,151 R176* probably null Het
Zbtb46 A G 2: 181,423,417 probably null Het
Zfp644 A G 5: 106,637,982 V233A probably benign Het
Other mutations in Bicral
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Bicral APN 17 46825352 missense probably benign 0.01
IGL01068:Bicral APN 17 46825391 missense probably damaging 1.00
IGL01899:Bicral APN 17 46824674 missense probably benign 0.08
IGL02321:Bicral APN 17 46811947 missense probably benign 0.01
IGL02425:Bicral APN 17 46808454 missense probably benign 0.05
R0091:Bicral UTSW 17 46825307 missense probably damaging 1.00
R0268:Bicral UTSW 17 46814052 splice site probably benign
R0344:Bicral UTSW 17 46814052 splice site probably benign
R0508:Bicral UTSW 17 46825401 missense possibly damaging 0.61
R0589:Bicral UTSW 17 46801596 missense probably benign 0.00
R1442:Bicral UTSW 17 46801724 missense probably benign 0.05
R1468:Bicral UTSW 17 46824593 missense probably benign 0.00
R1468:Bicral UTSW 17 46824593 missense probably benign 0.00
R1874:Bicral UTSW 17 46825178 missense probably benign 0.30
R2057:Bicral UTSW 17 46824888 missense possibly damaging 0.69
R2120:Bicral UTSW 17 46824815 missense probably benign 0.02
R2190:Bicral UTSW 17 46825123 missense probably damaging 0.98
R3737:Bicral UTSW 17 46825910 missense probably damaging 1.00
R3961:Bicral UTSW 17 46824825 missense probably damaging 0.96
R3977:Bicral UTSW 17 46830991 start codon destroyed unknown
R3979:Bicral UTSW 17 46830991 start codon destroyed unknown
R4183:Bicral UTSW 17 46814029 missense probably damaging 1.00
R4876:Bicral UTSW 17 46825576 missense probably damaging 1.00
R5104:Bicral UTSW 17 46801256 missense probably damaging 0.98
R5310:Bicral UTSW 17 46813983 missense possibly damaging 0.89
R5493:Bicral UTSW 17 46801694 missense possibly damaging 0.77
R5610:Bicral UTSW 17 46808492 missense probably damaging 0.99
R5771:Bicral UTSW 17 46825358 missense possibly damaging 0.59
R5891:Bicral UTSW 17 46801229 missense probably benign
R6426:Bicral UTSW 17 46830079 missense probably benign 0.36
R6497:Bicral UTSW 17 46825573 missense probably damaging 1.00
R7025:Bicral UTSW 17 46801668 missense probably benign
R7037:Bicral UTSW 17 46824634 missense probably benign 0.08
R7440:Bicral UTSW 17 46825784 missense probably damaging 1.00
R7997:Bicral UTSW 17 46801608 missense probably benign 0.37
V3553:Bicral UTSW 17 46830095 missense probably damaging 1.00
X0019:Bicral UTSW 17 46825821 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACGGCATTTGGAGAAGCC -3'
(R):5'- GTCCGTTGTCCTGTAGAACTG -3'

Sequencing Primer
(F):5'- CACTCATGGATTATTAAGAACAGGGC -3'
(R):5'- GAACTGTACTGTAGTTAACTCGCC -3'
Posted On2016-11-09