Incidental Mutation 'R5657:Tor1aip1'
ID442365
Institutional Source Beutler Lab
Gene Symbol Tor1aip1
Ensembl Gene ENSMUSG00000026466
Gene Nametorsin A interacting protein 1
SynonymsLAP1
MMRRC Submission 043171-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5657 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location156004599-156036480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 156007488 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 205 (H205N)
Ref Sequence ENSEMBL: ENSMUSP00000126751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027738] [ENSMUST00000097527] [ENSMUST00000130995] [ENSMUST00000136331] [ENSMUST00000136397] [ENSMUST00000141878] [ENSMUST00000169241]
Predicted Effect probably damaging
Transcript: ENSMUST00000027738
AA Change: H334N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027738
Gene: ENSMUSG00000026466
AA Change: H334N

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 265 9.1e-36 PFAM
Pfam:LAP1C 257 520 6.7e-171 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097527
AA Change: H390N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095134
Gene: ENSMUSG00000026466
AA Change: H390N

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
low complexity region 149 167 N/A INTRINSIC
Pfam:LAP1C 244 576 1.9e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130995
SMART Domains Protein: ENSMUSP00000141619
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 273 3.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136331
SMART Domains Protein: ENSMUSP00000137617
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 283 8.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136397
SMART Domains Protein: ENSMUSP00000118654
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
Pfam:LAP1C 1 77 5.6e-15 PFAM
Pfam:LAP1C 74 190 5.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141878
SMART Domains Protein: ENSMUSP00000123391
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
Pfam:LAP1C 1 176 1.4e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169241
AA Change: H205N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126751
Gene: ENSMUSG00000026466
AA Change: H205N

DomainStartEndE-ValueType
Pfam:LAP1C 1 77 1.6e-14 PFAM
Pfam:LAP1C 75 391 2.4e-195 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 2 integral membrane protein that binds A- and B-type lamins. The encoded protein localizes to the inner nuclear membrane and may be involved in maintaining the attachment of the nuclear membrane to the nuclear lamina during cell division. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit perinatal lethality and nuclear membrane blebs in neural and nonneural tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,046 Y533C probably damaging Het
Ahnak T C 19: 9,014,615 V4421A probably damaging Het
Bach1 A G 16: 87,719,285 K238R probably benign Het
Bloc1s6 T A 2: 122,738,657 V12D probably benign Het
Clca3b C A 3: 144,827,383 L629F probably benign Het
Clhc1 A G 11: 29,561,431 I292V probably benign Het
Col27a1 T C 4: 63,225,310 S412P probably damaging Het
Col6a4 A G 9: 106,072,198 I746T probably damaging Het
Cracr2a G A 6: 127,604,007 A49T probably damaging Het
Cyb561d1 A G 3: 108,200,692 I28T possibly damaging Het
Dnah11 T A 12: 117,883,617 M4264L probably damaging Het
Dnajc13 A G 9: 104,228,537 L412S probably damaging Het
Dpf3 T C 12: 83,325,011 N150S probably damaging Het
Epha2 T C 4: 141,323,494 C854R probably damaging Het
Fat2 G T 11: 55,310,681 Y522* probably null Het
Foxm1 A T 6: 128,373,388 S551C possibly damaging Het
Galnt12 T C 4: 47,104,150 V136A possibly damaging Het
Gm6647 T G 5: 13,768,821 noncoding transcript Het
Grin2b T A 6: 135,733,087 I1154F possibly damaging Het
Hmcn1 A G 1: 150,658,562 V2987A probably benign Het
Jade2 A G 11: 51,816,987 S800P probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr393 T C 11: 73,847,540 N195S probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plod1 T C 4: 147,918,781 E529G possibly damaging Het
Plppr2 T C 9: 21,947,615 C343R probably damaging Het
Prpf38a T C 4: 108,568,424 D219G probably damaging Het
Ptpra G A 2: 130,504,284 E122K probably benign Het
Rabl2 T C 15: 89,588,213 M38V probably benign Het
Reep1 A G 6: 71,761,374 M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,579,934 probably benign Het
Slc26a10 T C 10: 127,174,964 probably benign Het
Sun2 C A 15: 79,727,949 E510* probably null Het
Tanc1 A G 2: 59,834,707 probably null Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Trpc6 C T 9: 8,609,807 T92I probably benign Het
Vmn2r100 T A 17: 19,504,916 F36I probably benign Het
Zfp787 T C 7: 6,133,054 Y66C probably damaging Het
Other mutations in Tor1aip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Tor1aip1 APN 1 156031467 missense probably benign 0.01
IGL00837:Tor1aip1 APN 1 156006916 utr 3 prime probably benign
IGL02573:Tor1aip1 APN 1 156013371 missense probably damaging 0.99
IGL02815:Tor1aip1 APN 1 156035916 missense probably damaging 1.00
IGL02964:Tor1aip1 APN 1 156035844 missense probably damaging 0.96
IGL03128:Tor1aip1 APN 1 156007035 missense probably damaging 1.00
R0100:Tor1aip1 UTSW 1 156007075 missense probably damaging 1.00
R0319:Tor1aip1 UTSW 1 156007181 missense probably damaging 1.00
R0410:Tor1aip1 UTSW 1 156035940 missense possibly damaging 0.85
R0458:Tor1aip1 UTSW 1 156030407 missense probably damaging 0.99
R0506:Tor1aip1 UTSW 1 156007674 nonsense probably null
R0563:Tor1aip1 UTSW 1 156035808 missense probably damaging 1.00
R1696:Tor1aip1 UTSW 1 156017516 missense possibly damaging 0.67
R1745:Tor1aip1 UTSW 1 156030434 splice site probably null
R1830:Tor1aip1 UTSW 1 156007562 missense probably damaging 1.00
R2132:Tor1aip1 UTSW 1 156007562 missense probably damaging 1.00
R4487:Tor1aip1 UTSW 1 156007124 missense probably damaging 1.00
R5613:Tor1aip1 UTSW 1 156033753 missense probably damaging 0.98
R6123:Tor1aip1 UTSW 1 156007205 missense probably damaging 1.00
R6380:Tor1aip1 UTSW 1 156018488 missense possibly damaging 0.85
R6647:Tor1aip1 UTSW 1 156018253 missense possibly damaging 0.94
R6852:Tor1aip1 UTSW 1 156035820 missense probably damaging 0.99
R7354:Tor1aip1 UTSW 1 156036113 missense probably damaging 0.98
R7463:Tor1aip1 UTSW 1 156007609 missense possibly damaging 0.48
R7615:Tor1aip1 UTSW 1 156007584 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGTCAGCTCCTGATCGACTTC -3'
(R):5'- CTGTCAAGATAAAGTGGTGGCTG -3'

Sequencing Primer
(F):5'- GATCGACTTCATGCTTAACGAGGTC -3'
(R):5'- GCTGGGACTTGTTGCCATCC -3'
Posted On2016-11-09