Incidental Mutation 'R5657:Agbl5'
ID 442376
Institutional Source Beutler Lab
Gene Symbol Agbl5
Ensembl Gene ENSMUSG00000029165
Gene Name ATP/GTP binding protein-like 5
Synonyms Ccp5, 9430057O19Rik
MMRRC Submission 043171-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5657 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 31046038-31064309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31051390 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 533 (Y533C)
Ref Sequence ENSEMBL: ENSMUSP00000110348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069705] [ENSMUST00000114700] [ENSMUST00000200695] [ENSMUST00000200850] [ENSMUST00000201168] [ENSMUST00000201225] [ENSMUST00000201817] [ENSMUST00000201917] [ENSMUST00000202060] [ENSMUST00000202109]
AlphaFold Q09M02
Predicted Effect probably damaging
Transcript: ENSMUST00000069705
AA Change: Y504C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063228
Gene: ENSMUSG00000029165
AA Change: Y504C

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 191 361 8.4e-19 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 4e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114700
AA Change: Y533C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110348
Gene: ENSMUSG00000029165
AA Change: Y533C

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 220 390 1.1e-18 PFAM
low complexity region 413 428 N/A INTRINSIC
Blast:Zn_pept 453 518 5e-14 BLAST
low complexity region 567 577 N/A INTRINSIC
low complexity region 672 683 N/A INTRINSIC
low complexity region 743 762 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134956
AA Change: T529A
Predicted Effect probably benign
Transcript: ENSMUST00000200695
SMART Domains Protein: ENSMUSP00000144109
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d2ctc__ 148 177 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200850
SMART Domains Protein: ENSMUSP00000144274
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d1jqga1 178 229 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200990
Predicted Effect probably benign
Transcript: ENSMUST00000201014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201167
Predicted Effect probably damaging
Transcript: ENSMUST00000201168
AA Change: Y504C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143808
Gene: ENSMUSG00000029165
AA Change: Y504C

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 370 7.3e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 836 847 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201225
AA Change: Y504C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143934
Gene: ENSMUSG00000029165
AA Change: Y504C

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201817
AA Change: Y504C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144304
Gene: ENSMUSG00000029165
AA Change: Y504C

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.4e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201917
AA Change: Y504C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144188
Gene: ENSMUSG00000029165
AA Change: Y504C

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.5e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201918
Predicted Effect probably damaging
Transcript: ENSMUST00000202060
AA Change: Y504C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144018
Gene: ENSMUSG00000029165
AA Change: Y504C

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201523
Predicted Effect probably benign
Transcript: ENSMUST00000202109
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metallocarboxypeptidase involved in protein deglutamylation and a member of the peptidase M14 family of proteins. The encoded protein has been described as a "dual-functional" deglutamylase that can remove glutamate residues from both carboxyl termini and side chains of protein substrates. This deglutamylase activity may be important in antiviral immunity. Mutations in this gene are associated with retinitis pigmentosa. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to HSV or VACV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 8,991,979 (GRCm39) V4421A probably damaging Het
Bach1 A G 16: 87,516,173 (GRCm39) K238R probably benign Het
Bloc1s6 T A 2: 122,580,577 (GRCm39) V12D probably benign Het
Clca3b C A 3: 144,533,144 (GRCm39) L629F probably benign Het
Clhc1 A G 11: 29,511,431 (GRCm39) I292V probably benign Het
Col27a1 T C 4: 63,143,547 (GRCm39) S412P probably damaging Het
Col6a4 A G 9: 105,949,397 (GRCm39) I746T probably damaging Het
Cracr2a G A 6: 127,580,970 (GRCm39) A49T probably damaging Het
Cyb561d1 A G 3: 108,108,008 (GRCm39) I28T possibly damaging Het
Dnah11 T A 12: 117,847,352 (GRCm39) M4264L probably damaging Het
Dnajc13 A G 9: 104,105,736 (GRCm39) L412S probably damaging Het
Dpf3 T C 12: 83,371,785 (GRCm39) N150S probably damaging Het
Epha2 T C 4: 141,050,805 (GRCm39) C854R probably damaging Het
Fat2 G T 11: 55,201,507 (GRCm39) Y522* probably null Het
Foxm1 A T 6: 128,350,351 (GRCm39) S551C possibly damaging Het
Galnt12 T C 4: 47,104,150 (GRCm39) V136A possibly damaging Het
Gm6647 T G 5: 13,818,835 (GRCm39) noncoding transcript Het
Grin2b T A 6: 135,710,085 (GRCm39) I1154F possibly damaging Het
Hmcn1 A G 1: 150,534,313 (GRCm39) V2987A probably benign Het
Jade2 A G 11: 51,707,814 (GRCm39) S800P probably damaging Het
Naip6 C A 13: 100,436,909 (GRCm39) S538I probably benign Het
Or1e33 T C 11: 73,738,366 (GRCm39) N195S probably damaging Het
Plekha6 G C 1: 133,200,045 (GRCm39) R208P possibly damaging Het
Plod1 T C 4: 148,003,238 (GRCm39) E529G possibly damaging Het
Plppr2 T C 9: 21,858,911 (GRCm39) C343R probably damaging Het
Prpf38a T C 4: 108,425,621 (GRCm39) D219G probably damaging Het
Ptpra G A 2: 130,346,204 (GRCm39) E122K probably benign Het
Rabl2 T C 15: 89,472,416 (GRCm39) M38V probably benign Het
Reep1 A G 6: 71,738,358 (GRCm39) M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,229,141 (GRCm39) probably benign Het
Slc26a10 T C 10: 127,010,833 (GRCm39) probably benign Het
Sun2 C A 15: 79,612,150 (GRCm39) E510* probably null Het
Tanc1 A G 2: 59,665,051 (GRCm39) probably null Het
Ticam1 TCACACA TCACA 17: 56,577,629 (GRCm39) probably null Het
Tor1aip1 G T 1: 155,883,234 (GRCm39) H205N probably damaging Het
Trpc6 C T 9: 8,609,808 (GRCm39) T92I probably benign Het
Vmn2r100 T A 17: 19,725,178 (GRCm39) F36I probably benign Het
Zfp787 T C 7: 6,136,053 (GRCm39) Y66C probably damaging Het
Other mutations in Agbl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Agbl5 APN 5 31,050,578 (GRCm39) missense probably benign 0.00
sausage UTSW 5 31,051,702 (GRCm39) nonsense probably null
R0355:Agbl5 UTSW 5 31,049,335 (GRCm39) critical splice donor site probably null
R0575:Agbl5 UTSW 5 31,051,798 (GRCm39) missense probably damaging 1.00
R1694:Agbl5 UTSW 5 31,050,726 (GRCm39) missense probably damaging 1.00
R1709:Agbl5 UTSW 5 31,063,585 (GRCm39) missense probably damaging 1.00
R1829:Agbl5 UTSW 5 31,060,408 (GRCm39) missense possibly damaging 0.66
R2434:Agbl5 UTSW 5 31,051,357 (GRCm39) missense probably damaging 0.97
R3418:Agbl5 UTSW 5 31,062,067 (GRCm39) missense probably damaging 1.00
R4827:Agbl5 UTSW 5 31,053,158 (GRCm39) missense probably damaging 1.00
R4828:Agbl5 UTSW 5 31,048,059 (GRCm39) missense probably damaging 1.00
R4830:Agbl5 UTSW 5 31,048,059 (GRCm39) missense probably damaging 1.00
R5017:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5018:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5036:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5038:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5052:Agbl5 UTSW 5 31,048,558 (GRCm39) missense possibly damaging 0.76
R5071:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5073:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5074:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5081:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5083:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5103:Agbl5 UTSW 5 31,051,345 (GRCm39) missense probably damaging 1.00
R5107:Agbl5 UTSW 5 31,049,822 (GRCm39) missense probably damaging 1.00
R5130:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5395:Agbl5 UTSW 5 31,047,682 (GRCm39) missense probably damaging 1.00
R5522:Agbl5 UTSW 5 31,051,247 (GRCm39) splice site probably null
R5524:Agbl5 UTSW 5 31,051,247 (GRCm39) splice site probably null
R5526:Agbl5 UTSW 5 31,051,247 (GRCm39) splice site probably null
R5790:Agbl5 UTSW 5 31,051,702 (GRCm39) nonsense probably null
R6301:Agbl5 UTSW 5 31,049,177 (GRCm39) missense probably damaging 1.00
R6891:Agbl5 UTSW 5 31,052,522 (GRCm39) missense probably damaging 1.00
R6919:Agbl5 UTSW 5 31,062,061 (GRCm39) missense probably benign 0.13
R7388:Agbl5 UTSW 5 31,060,583 (GRCm39) nonsense probably null
R7392:Agbl5 UTSW 5 31,048,115 (GRCm39) critical splice donor site probably null
R7410:Agbl5 UTSW 5 31,048,032 (GRCm39) missense possibly damaging 0.94
R7452:Agbl5 UTSW 5 31,050,735 (GRCm39) missense probably damaging 1.00
R8312:Agbl5 UTSW 5 31,051,850 (GRCm39) missense probably damaging 1.00
R8901:Agbl5 UTSW 5 31,048,435 (GRCm39) missense possibly damaging 0.58
RF007:Agbl5 UTSW 5 31,060,589 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CATATGCGGCAGAGTAACACG -3'
(R):5'- CGAACGTGAAGAACTCCCAG -3'

Sequencing Primer
(F):5'- ACGACTGTGCCTTATTTTTCTTG -3'
(R):5'- GAATAATGCCAACCTTGCTAACTGAG -3'
Posted On 2016-11-09