Incidental Mutation 'R5657:Grin2b'
ID 442380
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Name glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms GluRepsilon2, GluN2B, NR2B, NMDAR2B, Nmdar2b
MMRRC Submission 043171-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5657 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 135690231-136150509 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 135710085 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1154 (I1154F)
Ref Sequence ENSEMBL: ENSMUSP00000107536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000053880
AA Change: I1154F

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: I1154F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111905
AA Change: I1154F

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: I1154F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136027
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 31,051,390 (GRCm39) Y533C probably damaging Het
Ahnak T C 19: 8,991,979 (GRCm39) V4421A probably damaging Het
Bach1 A G 16: 87,516,173 (GRCm39) K238R probably benign Het
Bloc1s6 T A 2: 122,580,577 (GRCm39) V12D probably benign Het
Clca3b C A 3: 144,533,144 (GRCm39) L629F probably benign Het
Clhc1 A G 11: 29,511,431 (GRCm39) I292V probably benign Het
Col27a1 T C 4: 63,143,547 (GRCm39) S412P probably damaging Het
Col6a4 A G 9: 105,949,397 (GRCm39) I746T probably damaging Het
Cracr2a G A 6: 127,580,970 (GRCm39) A49T probably damaging Het
Cyb561d1 A G 3: 108,108,008 (GRCm39) I28T possibly damaging Het
Dnah11 T A 12: 117,847,352 (GRCm39) M4264L probably damaging Het
Dnajc13 A G 9: 104,105,736 (GRCm39) L412S probably damaging Het
Dpf3 T C 12: 83,371,785 (GRCm39) N150S probably damaging Het
Epha2 T C 4: 141,050,805 (GRCm39) C854R probably damaging Het
Fat2 G T 11: 55,201,507 (GRCm39) Y522* probably null Het
Foxm1 A T 6: 128,350,351 (GRCm39) S551C possibly damaging Het
Galnt12 T C 4: 47,104,150 (GRCm39) V136A possibly damaging Het
Gm6647 T G 5: 13,818,835 (GRCm39) noncoding transcript Het
Hmcn1 A G 1: 150,534,313 (GRCm39) V2987A probably benign Het
Jade2 A G 11: 51,707,814 (GRCm39) S800P probably damaging Het
Naip6 C A 13: 100,436,909 (GRCm39) S538I probably benign Het
Or1e33 T C 11: 73,738,366 (GRCm39) N195S probably damaging Het
Plekha6 G C 1: 133,200,045 (GRCm39) R208P possibly damaging Het
Plod1 T C 4: 148,003,238 (GRCm39) E529G possibly damaging Het
Plppr2 T C 9: 21,858,911 (GRCm39) C343R probably damaging Het
Prpf38a T C 4: 108,425,621 (GRCm39) D219G probably damaging Het
Ptpra G A 2: 130,346,204 (GRCm39) E122K probably benign Het
Rabl2 T C 15: 89,472,416 (GRCm39) M38V probably benign Het
Reep1 A G 6: 71,738,358 (GRCm39) M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,229,141 (GRCm39) probably benign Het
Slc26a10 T C 10: 127,010,833 (GRCm39) probably benign Het
Sun2 C A 15: 79,612,150 (GRCm39) E510* probably null Het
Tanc1 A G 2: 59,665,051 (GRCm39) probably null Het
Ticam1 TCACACA TCACA 17: 56,577,629 (GRCm39) probably null Het
Tor1aip1 G T 1: 155,883,234 (GRCm39) H205N probably damaging Het
Trpc6 C T 9: 8,609,808 (GRCm39) T92I probably benign Het
Vmn2r100 T A 17: 19,725,178 (GRCm39) F36I probably benign Het
Zfp787 T C 7: 6,136,053 (GRCm39) Y66C probably damaging Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135,713,329 (GRCm39) missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135,710,568 (GRCm39) missense probably damaging 1.00
IGL01401:Grin2b APN 6 135,713,361 (GRCm39) missense probably damaging 1.00
IGL01523:Grin2b APN 6 136,021,263 (GRCm39) missense probably null 0.99
IGL01719:Grin2b APN 6 135,710,379 (GRCm39) missense probably damaging 0.97
IGL01907:Grin2b APN 6 135,710,738 (GRCm39) missense probably damaging 1.00
IGL01996:Grin2b APN 6 135,709,584 (GRCm39) missense probably damaging 1.00
IGL02309:Grin2b APN 6 135,713,470 (GRCm39) missense probably damaging 1.00
IGL02312:Grin2b APN 6 135,716,088 (GRCm39) missense probably damaging 1.00
IGL02409:Grin2b APN 6 136,020,906 (GRCm39) missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135,900,389 (GRCm39) missense probably damaging 1.00
IGL02535:Grin2b APN 6 135,756,367 (GRCm39) missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135,899,996 (GRCm39) missense probably damaging 1.00
IGL02702:Grin2b APN 6 135,716,130 (GRCm39) missense probably damaging 0.99
IGL03001:Grin2b APN 6 135,716,113 (GRCm39) missense probably damaging 1.00
IGL03274:Grin2b APN 6 135,757,253 (GRCm39) missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135,900,201 (GRCm39) missense probably benign
R0055:Grin2b UTSW 6 135,900,201 (GRCm39) missense probably benign
R0164:Grin2b UTSW 6 135,755,646 (GRCm39) splice site probably benign
R0194:Grin2b UTSW 6 135,756,303 (GRCm39) missense probably damaging 1.00
R0594:Grin2b UTSW 6 135,710,927 (GRCm39) missense probably damaging 1.00
R1434:Grin2b UTSW 6 135,820,193 (GRCm39) missense probably benign 0.04
R1928:Grin2b UTSW 6 136,021,044 (GRCm39) missense probably damaging 1.00
R1942:Grin2b UTSW 6 135,709,730 (GRCm39) missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136,021,209 (GRCm39) missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135,710,243 (GRCm39) missense probably damaging 1.00
R2020:Grin2b UTSW 6 135,710,894 (GRCm39) missense probably benign 0.12
R2103:Grin2b UTSW 6 135,757,138 (GRCm39) missense probably benign 0.02
R2127:Grin2b UTSW 6 135,755,698 (GRCm39) missense probably benign 0.03
R2495:Grin2b UTSW 6 135,710,180 (GRCm39) missense probably damaging 1.00
R2656:Grin2b UTSW 6 135,710,427 (GRCm39) missense probably damaging 1.00
R2847:Grin2b UTSW 6 135,717,951 (GRCm39) missense probably damaging 1.00
R2866:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R3196:Grin2b UTSW 6 135,709,453 (GRCm39) small deletion probably benign
R3418:Grin2b UTSW 6 135,820,108 (GRCm39) missense probably benign 0.02
R3808:Grin2b UTSW 6 135,900,269 (GRCm39) missense probably damaging 0.99
R4028:Grin2b UTSW 6 135,713,433 (GRCm39) missense probably damaging 1.00
R4602:Grin2b UTSW 6 135,755,739 (GRCm39) missense probably damaging 1.00
R4624:Grin2b UTSW 6 135,710,823 (GRCm39) missense probably damaging 0.99
R4677:Grin2b UTSW 6 135,751,870 (GRCm39) missense probably benign 0.13
R4744:Grin2b UTSW 6 135,755,697 (GRCm39) missense probably damaging 1.00
R5020:Grin2b UTSW 6 135,710,405 (GRCm39) missense probably benign 0.01
R5051:Grin2b UTSW 6 135,756,393 (GRCm39) missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135,709,439 (GRCm39) missense probably benign 0.03
R5125:Grin2b UTSW 6 135,900,297 (GRCm39) missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135,756,340 (GRCm39) missense probably damaging 1.00
R5318:Grin2b UTSW 6 135,710,916 (GRCm39) missense probably damaging 0.99
R5349:Grin2b UTSW 6 136,021,281 (GRCm39) missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135,709,366 (GRCm39) missense probably damaging 1.00
R5438:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5439:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5440:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5530:Grin2b UTSW 6 135,710,721 (GRCm39) missense probably benign 0.00
R5603:Grin2b UTSW 6 135,900,395 (GRCm39) missense probably damaging 1.00
R5788:Grin2b UTSW 6 135,717,962 (GRCm39) missense probably benign 0.24
R5941:Grin2b UTSW 6 135,713,371 (GRCm39) missense probably damaging 0.99
R6057:Grin2b UTSW 6 135,710,942 (GRCm39) missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135,900,456 (GRCm39) missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135,749,397 (GRCm39) missense probably damaging 1.00
R6309:Grin2b UTSW 6 135,710,025 (GRCm39) missense probably benign 0.00
R6316:Grin2b UTSW 6 135,757,277 (GRCm39) missense probably benign 0.00
R6419:Grin2b UTSW 6 135,717,965 (GRCm39) missense probably damaging 1.00
R6551:Grin2b UTSW 6 135,710,342 (GRCm39) missense probably damaging 1.00
R6612:Grin2b UTSW 6 135,717,996 (GRCm39) missense probably damaging 1.00
R6616:Grin2b UTSW 6 135,709,549 (GRCm39) missense probably benign
R6647:Grin2b UTSW 6 135,710,108 (GRCm39) missense probably damaging 1.00
R6806:Grin2b UTSW 6 135,751,826 (GRCm39) missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135,757,198 (GRCm39) missense probably benign
R7033:Grin2b UTSW 6 135,900,036 (GRCm39) missense probably damaging 1.00
R7058:Grin2b UTSW 6 135,757,304 (GRCm39) missense probably damaging 0.97
R7144:Grin2b UTSW 6 135,710,474 (GRCm39) missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135,709,946 (GRCm39) missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135,757,249 (GRCm39) missense probably damaging 0.97
R7453:Grin2b UTSW 6 135,717,947 (GRCm39) missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135,749,394 (GRCm39) missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135,756,301 (GRCm39) missense probably damaging 0.99
R7615:Grin2b UTSW 6 135,900,362 (GRCm39) missense probably damaging 1.00
R7632:Grin2b UTSW 6 135,709,553 (GRCm39) missense probably benign 0.02
R7779:Grin2b UTSW 6 135,755,792 (GRCm39) nonsense probably null
R8058:Grin2b UTSW 6 135,710,225 (GRCm39) missense probably damaging 1.00
R8084:Grin2b UTSW 6 135,710,486 (GRCm39) missense probably benign 0.03
R8145:Grin2b UTSW 6 135,709,497 (GRCm39) missense probably benign 0.01
R8308:Grin2b UTSW 6 135,900,074 (GRCm39) missense probably damaging 0.99
R8357:Grin2b UTSW 6 135,709,197 (GRCm39) missense probably benign 0.00
R8379:Grin2b UTSW 6 135,899,967 (GRCm39) missense probably damaging 1.00
R8429:Grin2b UTSW 6 135,710,914 (GRCm39) missense probably damaging 1.00
R8457:Grin2b UTSW 6 135,709,197 (GRCm39) missense probably benign 0.00
R8746:Grin2b UTSW 6 135,899,985 (GRCm39) missense probably benign 0.02
R8925:Grin2b UTSW 6 135,749,339 (GRCm39) missense probably damaging 0.97
R8927:Grin2b UTSW 6 135,749,339 (GRCm39) missense probably damaging 0.97
R8963:Grin2b UTSW 6 136,021,007 (GRCm39) missense probably damaging 1.00
R9075:Grin2b UTSW 6 135,709,509 (GRCm39) frame shift probably null
R9076:Grin2b UTSW 6 135,709,509 (GRCm39) frame shift probably null
R9172:Grin2b UTSW 6 135,756,255 (GRCm39) missense possibly damaging 0.84
R9520:Grin2b UTSW 6 135,710,399 (GRCm39) missense probably damaging 1.00
R9740:Grin2b UTSW 6 135,899,868 (GRCm39) critical splice donor site probably null
RF001:Grin2b UTSW 6 136,021,238 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCACCGTAGAGGAGTAATTGTG -3'
(R):5'- GCCAAATCTAGGAGGGAGTTTG -3'

Sequencing Primer
(F):5'- CAGCTGCGGCAGAAGTTG -3'
(R):5'- TTGATGAAATCGAGCTGGCCTAC -3'
Posted On 2016-11-09