Incidental Mutation 'R5657:Slc26a10'
ID442390
Institutional Source Beutler Lab
Gene Symbol Slc26a10
Ensembl Gene ENSMUSG00000040441
Gene Namesolute carrier family 26, member 10
Synonyms
MMRRC Submission 043171-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5657 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127171393-127180645 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 127174964 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006914] [ENSMUST00000095270] [ENSMUST00000095270] [ENSMUST00000217678] [ENSMUST00000222911]
Predicted Effect probably benign
Transcript: ENSMUST00000006914
SMART Domains Protein: ENSMUSP00000006914
Gene: ENSMUSG00000006731

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
Pfam:Glycos_transf_2 280 450 7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095270
SMART Domains Protein: ENSMUSP00000092904
Gene: ENSMUSG00000040441

DomainStartEndE-ValueType
low complexity region 51 78 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:Sulfate_transp 105 497 5.5e-103 PFAM
low complexity region 512 522 N/A INTRINSIC
Pfam:STAS 549 664 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095270
SMART Domains Protein: ENSMUSP00000092904
Gene: ENSMUSG00000040441

DomainStartEndE-ValueType
low complexity region 51 78 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:Sulfate_transp 105 497 5.5e-103 PFAM
low complexity region 512 522 N/A INTRINSIC
Pfam:STAS 549 664 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221174
Predicted Effect probably benign
Transcript: ENSMUST00000222911
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,046 Y533C probably damaging Het
Ahnak T C 19: 9,014,615 V4421A probably damaging Het
Bach1 A G 16: 87,719,285 K238R probably benign Het
Bloc1s6 T A 2: 122,738,657 V12D probably benign Het
Clca3b C A 3: 144,827,383 L629F probably benign Het
Clhc1 A G 11: 29,561,431 I292V probably benign Het
Col27a1 T C 4: 63,225,310 S412P probably damaging Het
Col6a4 A G 9: 106,072,198 I746T probably damaging Het
Cracr2a G A 6: 127,604,007 A49T probably damaging Het
Cyb561d1 A G 3: 108,200,692 I28T possibly damaging Het
Dnah11 T A 12: 117,883,617 M4264L probably damaging Het
Dnajc13 A G 9: 104,228,537 L412S probably damaging Het
Dpf3 T C 12: 83,325,011 N150S probably damaging Het
Epha2 T C 4: 141,323,494 C854R probably damaging Het
Fat2 G T 11: 55,310,681 Y522* probably null Het
Foxm1 A T 6: 128,373,388 S551C possibly damaging Het
Galnt12 T C 4: 47,104,150 V136A possibly damaging Het
Gm6647 T G 5: 13,768,821 noncoding transcript Het
Grin2b T A 6: 135,733,087 I1154F possibly damaging Het
Hmcn1 A G 1: 150,658,562 V2987A probably benign Het
Jade2 A G 11: 51,816,987 S800P probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr393 T C 11: 73,847,540 N195S probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plod1 T C 4: 147,918,781 E529G possibly damaging Het
Plppr2 T C 9: 21,947,615 C343R probably damaging Het
Prpf38a T C 4: 108,568,424 D219G probably damaging Het
Ptpra G A 2: 130,504,284 E122K probably benign Het
Rabl2 T C 15: 89,588,213 M38V probably benign Het
Reep1 A G 6: 71,761,374 M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,579,934 probably benign Het
Sun2 C A 15: 79,727,949 E510* probably null Het
Tanc1 A G 2: 59,834,707 probably null Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tor1aip1 G T 1: 156,007,488 H205N probably damaging Het
Trpc6 C T 9: 8,609,807 T92I probably benign Het
Vmn2r100 T A 17: 19,504,916 F36I probably benign Het
Zfp787 T C 7: 6,133,054 Y66C probably damaging Het
Other mutations in Slc26a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Slc26a10 APN 10 127174177 splice site probably benign
IGL01657:Slc26a10 APN 10 127175034 missense probably damaging 1.00
R1202:Slc26a10 UTSW 10 127173348 missense probably damaging 0.99
R1844:Slc26a10 UTSW 10 127178410 missense probably damaging 0.97
R2423:Slc26a10 UTSW 10 127179737 critical splice acceptor site probably null
R4031:Slc26a10 UTSW 10 127178002 missense possibly damaging 0.57
R4779:Slc26a10 UTSW 10 127173355 missense possibly damaging 0.73
R5405:Slc26a10 UTSW 10 127174995 missense probably benign 0.09
R5478:Slc26a10 UTSW 10 127173949 missense probably benign 0.05
R5990:Slc26a10 UTSW 10 127178758 missense possibly damaging 0.81
R6681:Slc26a10 UTSW 10 127173661 missense possibly damaging 0.93
R7083:Slc26a10 UTSW 10 127177168 missense probably damaging 1.00
R7365:Slc26a10 UTSW 10 127176847 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTTGGTCCATGGCAAAACCG -3'
(R):5'- TTTTGAAGAAGATGAGACAGGCTAGTC -3'

Sequencing Primer
(F):5'- AAAACCGGGGCGCTTGG -3'
(R):5'- CTAGTCGGCCAGGGAGAG -3'
Posted On2016-11-09