Incidental Mutation 'R5657:Clhc1'
ID442391
Institutional Source Beutler Lab
Gene Symbol Clhc1
Ensembl Gene ENSMUSG00000020461
Gene Nameclathrin heavy chain linker domain containing 1
Synonyms1700034F02Rik
MMRRC Submission 043171-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5657 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location29547950-29578367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29561431 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 292 (I292V)
Ref Sequence ENSEMBL: ENSMUSP00000147007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020753] [ENSMUST00000208530]
Predicted Effect probably benign
Transcript: ENSMUST00000020753
AA Change: I303V

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000020753
Gene: ENSMUSG00000020461
AA Change: I303V

DomainStartEndE-ValueType
Pfam:TSNAXIP1_N 28 152 2.6e-26 PFAM
Pfam:Clathrin_H_link 302 365 3.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131366
Predicted Effect probably benign
Transcript: ENSMUST00000208530
AA Change: I292V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,046 Y533C probably damaging Het
Ahnak T C 19: 9,014,615 V4421A probably damaging Het
Bach1 A G 16: 87,719,285 K238R probably benign Het
Bloc1s6 T A 2: 122,738,657 V12D probably benign Het
Clca3b C A 3: 144,827,383 L629F probably benign Het
Col27a1 T C 4: 63,225,310 S412P probably damaging Het
Col6a4 A G 9: 106,072,198 I746T probably damaging Het
Cracr2a G A 6: 127,604,007 A49T probably damaging Het
Cyb561d1 A G 3: 108,200,692 I28T possibly damaging Het
Dnah11 T A 12: 117,883,617 M4264L probably damaging Het
Dnajc13 A G 9: 104,228,537 L412S probably damaging Het
Dpf3 T C 12: 83,325,011 N150S probably damaging Het
Epha2 T C 4: 141,323,494 C854R probably damaging Het
Fat2 G T 11: 55,310,681 Y522* probably null Het
Foxm1 A T 6: 128,373,388 S551C possibly damaging Het
Galnt12 T C 4: 47,104,150 V136A possibly damaging Het
Gm6647 T G 5: 13,768,821 noncoding transcript Het
Grin2b T A 6: 135,733,087 I1154F possibly damaging Het
Hmcn1 A G 1: 150,658,562 V2987A probably benign Het
Jade2 A G 11: 51,816,987 S800P probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr393 T C 11: 73,847,540 N195S probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plod1 T C 4: 147,918,781 E529G possibly damaging Het
Plppr2 T C 9: 21,947,615 C343R probably damaging Het
Prpf38a T C 4: 108,568,424 D219G probably damaging Het
Ptpra G A 2: 130,504,284 E122K probably benign Het
Rabl2 T C 15: 89,588,213 M38V probably benign Het
Reep1 A G 6: 71,761,374 M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,579,934 probably benign Het
Slc26a10 T C 10: 127,174,964 probably benign Het
Sun2 C A 15: 79,727,949 E510* probably null Het
Tanc1 A G 2: 59,834,707 probably null Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tor1aip1 G T 1: 156,007,488 H205N probably damaging Het
Trpc6 C T 9: 8,609,807 T92I probably benign Het
Vmn2r100 T A 17: 19,504,916 F36I probably benign Het
Zfp787 T C 7: 6,133,054 Y66C probably damaging Het
Other mutations in Clhc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Clhc1 APN 11 29571745 missense probably damaging 0.99
IGL00976:Clhc1 APN 11 29561389 missense probably benign 0.43
IGL01826:Clhc1 APN 11 29553765 splice site probably null
IGL02029:Clhc1 APN 11 29560798 missense probably benign 0.01
IGL02479:Clhc1 APN 11 29578107 missense probably damaging 0.98
R0553:Clhc1 UTSW 11 29561366 splice site probably benign
R1313:Clhc1 UTSW 11 29571678 missense probably benign
R1313:Clhc1 UTSW 11 29571678 missense probably benign
R1482:Clhc1 UTSW 11 29553725 missense probably damaging 1.00
R1624:Clhc1 UTSW 11 29569287 missense possibly damaging 0.85
R1742:Clhc1 UTSW 11 29557647 splice site probably null
R2094:Clhc1 UTSW 11 29557771 missense probably benign 0.13
R2130:Clhc1 UTSW 11 29557663 missense probably benign 0.33
R2237:Clhc1 UTSW 11 29569329 missense probably benign 0.30
R3814:Clhc1 UTSW 11 29571826 missense possibly damaging 0.57
R3854:Clhc1 UTSW 11 29571789 missense probably damaging 1.00
R4417:Clhc1 UTSW 11 29571826 missense possibly damaging 0.57
R4659:Clhc1 UTSW 11 29578229 makesense probably null
R5021:Clhc1 UTSW 11 29560627 missense probably benign 0.01
R5246:Clhc1 UTSW 11 29575434 missense probably damaging 1.00
R5287:Clhc1 UTSW 11 29578244 utr 3 prime probably benign
R5771:Clhc1 UTSW 11 29563854 missense possibly damaging 0.94
R6050:Clhc1 UTSW 11 29561397 missense possibly damaging 0.76
R6211:Clhc1 UTSW 11 29578145 missense probably damaging 1.00
R6500:Clhc1 UTSW 11 29560542 missense possibly damaging 0.87
R6615:Clhc1 UTSW 11 29578149 missense possibly damaging 0.75
R6944:Clhc1 UTSW 11 29569346 missense probably damaging 0.97
R7252:Clhc1 UTSW 11 29563937 missense probably benign 0.01
X0023:Clhc1 UTSW 11 29569305 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACTTTAGGAAGGGGCTGG -3'
(R):5'- TTGAACTGCTATCCCAATGACCC -3'

Sequencing Primer
(F):5'- CTGGTGTTGTGTGAAAGCAAAG -3'
(R):5'- TGCAGGCTAGCAGTCAGG -3'
Posted On2016-11-09