Incidental Mutation 'R5657:Jade2'
ID442392
Institutional Source Beutler Lab
Gene Symbol Jade2
Ensembl Gene ENSMUSG00000020387
Gene Namejade family PHD finger 2
SynonymsPhf15, 1200017K05Rik
MMRRC Submission 043171-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5657 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location51813455-51857653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51816987 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 800 (S800P)
Ref Sequence ENSEMBL: ENSMUSP00000104719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020655] [ENSMUST00000109090] [ENSMUST00000109091]
Predicted Effect probably damaging
Transcript: ENSMUST00000020655
AA Change: S800P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020655
Gene: ENSMUSG00000020387
AA Change: S800P

DomainStartEndE-ValueType
Pfam:EPL1 39 177 3.4e-17 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109090
SMART Domains Protein: ENSMUSP00000104718
Gene: ENSMUSG00000020387

DomainStartEndE-ValueType
Pfam:EPL1 39 177 2e-17 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109091
AA Change: S800P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104719
Gene: ENSMUSG00000020387
AA Change: S800P

DomainStartEndE-ValueType
Pfam:EPL1 2 176 9.6e-9 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,046 Y533C probably damaging Het
Ahnak T C 19: 9,014,615 V4421A probably damaging Het
Bach1 A G 16: 87,719,285 K238R probably benign Het
Bloc1s6 T A 2: 122,738,657 V12D probably benign Het
Clca3b C A 3: 144,827,383 L629F probably benign Het
Clhc1 A G 11: 29,561,431 I292V probably benign Het
Col27a1 T C 4: 63,225,310 S412P probably damaging Het
Col6a4 A G 9: 106,072,198 I746T probably damaging Het
Cracr2a G A 6: 127,604,007 A49T probably damaging Het
Cyb561d1 A G 3: 108,200,692 I28T possibly damaging Het
Dnah11 T A 12: 117,883,617 M4264L probably damaging Het
Dnajc13 A G 9: 104,228,537 L412S probably damaging Het
Dpf3 T C 12: 83,325,011 N150S probably damaging Het
Epha2 T C 4: 141,323,494 C854R probably damaging Het
Fat2 G T 11: 55,310,681 Y522* probably null Het
Foxm1 A T 6: 128,373,388 S551C possibly damaging Het
Galnt12 T C 4: 47,104,150 V136A possibly damaging Het
Gm6647 T G 5: 13,768,821 noncoding transcript Het
Grin2b T A 6: 135,733,087 I1154F possibly damaging Het
Hmcn1 A G 1: 150,658,562 V2987A probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr393 T C 11: 73,847,540 N195S probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plod1 T C 4: 147,918,781 E529G possibly damaging Het
Plppr2 T C 9: 21,947,615 C343R probably damaging Het
Prpf38a T C 4: 108,568,424 D219G probably damaging Het
Ptpra G A 2: 130,504,284 E122K probably benign Het
Rabl2 T C 15: 89,588,213 M38V probably benign Het
Reep1 A G 6: 71,761,374 M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,579,934 probably benign Het
Slc26a10 T C 10: 127,174,964 probably benign Het
Sun2 C A 15: 79,727,949 E510* probably null Het
Tanc1 A G 2: 59,834,707 probably null Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tor1aip1 G T 1: 156,007,488 H205N probably damaging Het
Trpc6 C T 9: 8,609,807 T92I probably benign Het
Vmn2r100 T A 17: 19,504,916 F36I probably benign Het
Zfp787 T C 7: 6,133,054 Y66C probably damaging Het
Other mutations in Jade2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Jade2 APN 11 51825338 missense possibly damaging 0.95
IGL01935:Jade2 APN 11 51828384 missense possibly damaging 0.95
IGL02885:Jade2 APN 11 51831296 missense probably damaging 1.00
IGL02987:Jade2 APN 11 51830481 missense probably damaging 1.00
IGL02990:Jade2 APN 11 51831247 splice site probably benign
IGL03172:Jade2 APN 11 51825371 missense probably damaging 1.00
R0116:Jade2 UTSW 11 51831309 missense probably damaging 1.00
R1917:Jade2 UTSW 11 51818538 missense possibly damaging 0.95
R3410:Jade2 UTSW 11 51817223 missense probably benign
R3886:Jade2 UTSW 11 51830499 missense possibly damaging 0.79
R4846:Jade2 UTSW 11 51821148 missense probably benign
R4916:Jade2 UTSW 11 51817082 missense probably benign 0.01
R5420:Jade2 UTSW 11 51818607 missense probably benign 0.21
R5446:Jade2 UTSW 11 51816959 missense probably benign
R6031:Jade2 UTSW 11 51826586 nonsense probably null
R6031:Jade2 UTSW 11 51826586 nonsense probably null
R6116:Jade2 UTSW 11 51835633 missense probably damaging 0.99
R7039:Jade2 UTSW 11 51828359 missense probably damaging 0.97
R7270:Jade2 UTSW 11 51817184 missense possibly damaging 0.89
R7702:Jade2 UTSW 11 51816917 missense probably damaging 1.00
R7797:Jade2 UTSW 11 51817299 missense probably benign 0.00
R8054:Jade2 UTSW 11 51818614 missense probably benign 0.00
R8243:Jade2 UTSW 11 51817218 missense probably benign
R8371:Jade2 UTSW 11 51825132 missense probably benign 0.04
Z1177:Jade2 UTSW 11 51816990 missense probably damaging 0.96
Z1177:Jade2 UTSW 11 51848994 missense probably null 0.20
Predicted Primers PCR Primer
(F):5'- ACACTCAGCAGTTGGAAATGG -3'
(R):5'- GCCTCCGAGATACTAGACAAG -3'

Sequencing Primer
(F):5'- CTCAGCAGTTGGAAATGGCAGTTG -3'
(R):5'- TAAATGTCCAAGTGCCTGGC -3'
Posted On2016-11-09