Incidental Mutation 'R5657:Olfr393'
ID442394
Institutional Source Beutler Lab
Gene Symbol Olfr393
Ensembl Gene ENSMUSG00000094488
Gene Nameolfactory receptor 393
SynonymsGA_x6K02T2P1NL-4004140-4003208, MOR135-7
MMRRC Submission 043171-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5657 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73844413-73851454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73847540 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 195 (N195S)
Ref Sequence ENSEMBL: ENSMUSP00000150031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102523] [ENSMUST00000213365]
Predicted Effect probably damaging
Transcript: ENSMUST00000102523
AA Change: N195S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099582
Gene: ENSMUSG00000094488
AA Change: N195S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.5e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.3e-7 PFAM
Pfam:7tm_1 41 290 4.8e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213365
AA Change: N195S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,046 Y533C probably damaging Het
Ahnak T C 19: 9,014,615 V4421A probably damaging Het
Bach1 A G 16: 87,719,285 K238R probably benign Het
Bloc1s6 T A 2: 122,738,657 V12D probably benign Het
Clca3b C A 3: 144,827,383 L629F probably benign Het
Clhc1 A G 11: 29,561,431 I292V probably benign Het
Col27a1 T C 4: 63,225,310 S412P probably damaging Het
Col6a4 A G 9: 106,072,198 I746T probably damaging Het
Cracr2a G A 6: 127,604,007 A49T probably damaging Het
Cyb561d1 A G 3: 108,200,692 I28T possibly damaging Het
Dnah11 T A 12: 117,883,617 M4264L probably damaging Het
Dnajc13 A G 9: 104,228,537 L412S probably damaging Het
Dpf3 T C 12: 83,325,011 N150S probably damaging Het
Epha2 T C 4: 141,323,494 C854R probably damaging Het
Fat2 G T 11: 55,310,681 Y522* probably null Het
Foxm1 A T 6: 128,373,388 S551C possibly damaging Het
Galnt12 T C 4: 47,104,150 V136A possibly damaging Het
Gm6647 T G 5: 13,768,821 noncoding transcript Het
Grin2b T A 6: 135,733,087 I1154F possibly damaging Het
Hmcn1 A G 1: 150,658,562 V2987A probably benign Het
Jade2 A G 11: 51,816,987 S800P probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plod1 T C 4: 147,918,781 E529G possibly damaging Het
Plppr2 T C 9: 21,947,615 C343R probably damaging Het
Prpf38a T C 4: 108,568,424 D219G probably damaging Het
Ptpra G A 2: 130,504,284 E122K probably benign Het
Rabl2 T C 15: 89,588,213 M38V probably benign Het
Reep1 A G 6: 71,761,374 M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,579,934 probably benign Het
Slc26a10 T C 10: 127,174,964 probably benign Het
Sun2 C A 15: 79,727,949 E510* probably null Het
Tanc1 A G 2: 59,834,707 probably null Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tor1aip1 G T 1: 156,007,488 H205N probably damaging Het
Trpc6 C T 9: 8,609,807 T92I probably benign Het
Vmn2r100 T A 17: 19,504,916 F36I probably benign Het
Zfp787 T C 7: 6,133,054 Y66C probably damaging Het
Other mutations in Olfr393
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Olfr393 APN 11 73847210 missense probably benign 0.00
IGL01845:Olfr393 APN 11 73847472 missense probably damaging 1.00
IGL01969:Olfr393 APN 11 73847609 missense possibly damaging 0.56
IGL02288:Olfr393 APN 11 73847381 missense possibly damaging 0.88
IGL02726:Olfr393 APN 11 73847865 missense probably benign 0.02
R0400:Olfr393 UTSW 11 73848041 missense probably benign 0.15
R1672:Olfr393 UTSW 11 73847955 missense probably benign 0.31
R1816:Olfr393 UTSW 11 73847199 missense probably benign 0.00
R2294:Olfr393 UTSW 11 73847486 missense probably damaging 1.00
R4506:Olfr393 UTSW 11 73847695 nonsense probably null
R4587:Olfr393 UTSW 11 73847219 missense probably benign 0.12
R4593:Olfr393 UTSW 11 73847314 missense probably benign 0.22
R5216:Olfr393 UTSW 11 73847436 missense probably damaging 0.97
R5763:Olfr393 UTSW 11 73847867 missense probably benign 0.01
R5912:Olfr393 UTSW 11 73847675 missense possibly damaging 0.61
R6025:Olfr393 UTSW 11 73847919 missense probably benign 0.23
R6630:Olfr393 UTSW 11 73847876 missense probably benign
R6804:Olfr393 UTSW 11 73847414 missense probably benign 0.00
R7363:Olfr393 UTSW 11 73847915 missense probably damaging 1.00
R7860:Olfr393 UTSW 11 73847507 missense probably benign 0.07
R8103:Olfr393 UTSW 11 73847909 missense probably damaging 1.00
R8158:Olfr393 UTSW 11 73847871 missense probably benign 0.01
Z1177:Olfr393 UTSW 11 73847801 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ACCTGATGGACATAAGTAGAGACC -3'
(R):5'- GCATTACACCAGCATCATGAGC -3'

Sequencing Primer
(F):5'- AGTAGAGACCAATAATTGTCCCATAG -3'
(R):5'- GCCCCAAGCTCTGTACTTG -3'
Posted On2016-11-09