Incidental Mutation 'R5657:Dpf3'
ID442395
Institutional Source Beutler Lab
Gene Symbol Dpf3
Ensembl Gene ENSMUSG00000021221
Gene NameD4, zinc and double PHD fingers, family 3
Synonymscer-d4, 2810403B03Rik, CERD4
MMRRC Submission 043171-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R5657 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location83213745-83487716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83325011 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 150 (N150S)
Ref Sequence ENSEMBL: ENSMUSP00000137477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177801] [ENSMUST00000177959] [ENSMUST00000178756]
Predicted Effect unknown
Transcript: ENSMUST00000133282
AA Change: N85S
SMART Domains Protein: ENSMUSP00000121199
Gene: ENSMUSG00000021221
AA Change: N85S

DomainStartEndE-ValueType
low complexity region 80 100 N/A INTRINSIC
low complexity region 106 124 N/A INTRINSIC
ZnF_C2H2 133 156 1.82e-3 SMART
PDB:2KWO|A 195 227 2e-14 PDB
Blast:PHD 196 227 5e-14 BLAST
low complexity region 230 246 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000144237
AA Change: N86S
SMART Domains Protein: ENSMUSP00000122004
Gene: ENSMUSG00000021221
AA Change: N86S

DomainStartEndE-ValueType
low complexity region 81 101 N/A INTRINSIC
low complexity region 107 125 N/A INTRINSIC
ZnF_C2H2 134 157 1.82e-3 SMART
PDB:2KWO|A 196 228 2e-14 PDB
Blast:PHD 197 228 5e-14 BLAST
low complexity region 231 247 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000147469
AA Change: N86S
SMART Domains Protein: ENSMUSP00000122598
Gene: ENSMUSG00000021221
AA Change: N86S

DomainStartEndE-ValueType
low complexity region 81 101 N/A INTRINSIC
low complexity region 107 125 N/A INTRINSIC
ZnF_C2H2 134 157 1.82e-3 SMART
PHD 197 253 3.27e-9 SMART
RING 198 252 3.44e0 SMART
PHD 254 300 1.53e-9 SMART
RING 255 299 1.38e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177801
AA Change: N109S
SMART Domains Protein: ENSMUSP00000136740
Gene: ENSMUSG00000021221
AA Change: N109S

DomainStartEndE-ValueType
Pfam:Requiem_N 8 43 2.9e-13 PFAM
low complexity region 103 123 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
ZnF_C2H2 156 179 1.82e-3 SMART
PDB:2KWO|A 218 250 4e-14 PDB
Blast:PHD 219 250 9e-14 BLAST
low complexity region 253 269 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177959
AA Change: N150S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137477
Gene: ENSMUSG00000021221
AA Change: N150S

DomainStartEndE-ValueType
Pfam:Requiem_N 12 85 2.6e-40 PFAM
low complexity region 144 164 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
ZnF_C2H2 197 220 1.82e-3 SMART
PDB:2KWO|A 259 291 4e-14 PDB
Blast:PHD 260 291 1e-13 BLAST
low complexity region 294 310 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178756
AA Change: N151S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136280
Gene: ENSMUSG00000021221
AA Change: N151S

DomainStartEndE-ValueType
Pfam:Requiem_N 13 84 4.8e-40 PFAM
low complexity region 145 165 N/A INTRINSIC
low complexity region 171 189 N/A INTRINSIC
ZnF_C2H2 198 221 1.82e-3 SMART
PHD 261 317 3.27e-9 SMART
RING 262 316 3.44e0 SMART
PHD 318 364 1.53e-9 SMART
RING 319 363 1.38e0 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the D4 protein family. The encoded protein is a transcription regulator that binds acetylated histones and is a component of the BAF chromatin remodeling complex. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null allele display no detectable phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,046 Y533C probably damaging Het
Ahnak T C 19: 9,014,615 V4421A probably damaging Het
Bach1 A G 16: 87,719,285 K238R probably benign Het
Bloc1s6 T A 2: 122,738,657 V12D probably benign Het
Clca3b C A 3: 144,827,383 L629F probably benign Het
Clhc1 A G 11: 29,561,431 I292V probably benign Het
Col27a1 T C 4: 63,225,310 S412P probably damaging Het
Col6a4 A G 9: 106,072,198 I746T probably damaging Het
Cracr2a G A 6: 127,604,007 A49T probably damaging Het
Cyb561d1 A G 3: 108,200,692 I28T possibly damaging Het
Dnah11 T A 12: 117,883,617 M4264L probably damaging Het
Dnajc13 A G 9: 104,228,537 L412S probably damaging Het
Epha2 T C 4: 141,323,494 C854R probably damaging Het
Fat2 G T 11: 55,310,681 Y522* probably null Het
Foxm1 A T 6: 128,373,388 S551C possibly damaging Het
Galnt12 T C 4: 47,104,150 V136A possibly damaging Het
Gm6647 T G 5: 13,768,821 noncoding transcript Het
Grin2b T A 6: 135,733,087 I1154F possibly damaging Het
Hmcn1 A G 1: 150,658,562 V2987A probably benign Het
Jade2 A G 11: 51,816,987 S800P probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr393 T C 11: 73,847,540 N195S probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plod1 T C 4: 147,918,781 E529G possibly damaging Het
Plppr2 T C 9: 21,947,615 C343R probably damaging Het
Prpf38a T C 4: 108,568,424 D219G probably damaging Het
Ptpra G A 2: 130,504,284 E122K probably benign Het
Rabl2 T C 15: 89,588,213 M38V probably benign Het
Reep1 A G 6: 71,761,374 M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,579,934 probably benign Het
Slc26a10 T C 10: 127,174,964 probably benign Het
Sun2 C A 15: 79,727,949 E510* probably null Het
Tanc1 A G 2: 59,834,707 probably null Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tor1aip1 G T 1: 156,007,488 H205N probably damaging Het
Trpc6 C T 9: 8,609,807 T92I probably benign Het
Vmn2r100 T A 17: 19,504,916 F36I probably benign Het
Zfp787 T C 7: 6,133,054 Y66C probably damaging Het
Other mutations in Dpf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01452:Dpf3 APN 12 83269489 missense probably benign
IGL01719:Dpf3 APN 12 83294433 missense probably damaging 0.99
IGL01950:Dpf3 APN 12 83324949 missense probably benign 0.00
R0457:Dpf3 UTSW 12 83272405 missense probably damaging 0.96
R1104:Dpf3 UTSW 12 83331987 missense probably benign 0.30
R1565:Dpf3 UTSW 12 83370617 missense probably damaging 0.98
R1969:Dpf3 UTSW 12 83325035 critical splice acceptor site probably null
R1970:Dpf3 UTSW 12 83325035 critical splice acceptor site probably null
R1971:Dpf3 UTSW 12 83325035 critical splice acceptor site probably null
R2344:Dpf3 UTSW 12 83350820 missense probably damaging 1.00
R3732:Dpf3 UTSW 12 83269507 missense possibly damaging 0.90
R4828:Dpf3 UTSW 12 83294499 missense possibly damaging 0.89
R4936:Dpf3 UTSW 12 83331966 missense probably damaging 1.00
R4970:Dpf3 UTSW 12 83370611 nonsense probably null
R4993:Dpf3 UTSW 12 83331861 critical splice donor site probably null
R5112:Dpf3 UTSW 12 83370611 nonsense probably null
R5182:Dpf3 UTSW 12 83370596 missense probably damaging 0.99
R5638:Dpf3 UTSW 12 83324940 missense probably damaging 1.00
R7472:Dpf3 UTSW 12 83272385 missense probably benign 0.37
R7481:Dpf3 UTSW 12 83331927 missense probably damaging 1.00
R8350:Dpf3 UTSW 12 83350851 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGCACTGGACATTGCAG -3'
(R):5'- ACCGAGACTTCAAACTCTTAGG -3'

Sequencing Primer
(F):5'- CACTGGACATTGCAGGCATG -3'
(R):5'- TTCAAACTCTTAGGCAGCGG -3'
Posted On2016-11-09