Incidental Mutation 'R5657:Rabl2'
ID442400
Institutional Source Beutler Lab
Gene Symbol Rabl2
Ensembl Gene ENSMUSG00000022621
Gene NameRAB, member RAS oncogene family-like 2
Synonyms1110031N17Rik, Rabl2a
MMRRC Submission 043171-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5657 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89582533-89591923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89588213 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 38 (M38V)
Ref Sequence ENSEMBL: ENSMUSP00000126182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023294] [ENSMUST00000094056] [ENSMUST00000169466] [ENSMUST00000170126] [ENSMUST00000171580] [ENSMUST00000172053]
Predicted Effect probably benign
Transcript: ENSMUST00000023294
AA Change: M38V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023294
Gene: ENSMUSG00000022621
AA Change: M38V

DomainStartEndE-ValueType
Pfam:Arf 10 196 2.3e-12 PFAM
Pfam:MMR_HSR1 23 134 1.4e-6 PFAM
Pfam:Roc 23 137 2e-35 PFAM
Pfam:Gtr1_RagA 23 171 9e-8 PFAM
Pfam:Ras 23 180 3.8e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094056
SMART Domains Protein: ENSMUSP00000091598
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
Blast:RAB 50 94 4e-10 BLAST
SCOP:d3raba_ 57 91 1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165747
Predicted Effect probably benign
Transcript: ENSMUST00000169466
SMART Domains Protein: ENSMUSP00000129660
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
SCOP:d1ek0a_ 21 53 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170126
AA Change: M38V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126182
Gene: ENSMUSG00000022621
AA Change: M38V

DomainStartEndE-ValueType
Pfam:Ras 23 74 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171142
Predicted Effect probably benign
Transcript: ENSMUST00000171580
SMART Domains Protein: ENSMUSP00000128799
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
SCOP:d1ek0a_ 21 38 7e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171826
SMART Domains Protein: ENSMUSP00000129221
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
Blast:RAB 2 49 7e-16 BLAST
SCOP:d1fzqa_ 3 49 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172053
AA Change: M38V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129253
Gene: ENSMUSG00000022621
AA Change: M38V

DomainStartEndE-ValueType
Pfam:Arf 10 100 6.5e-9 PFAM
Pfam:Miro 23 102 1.7e-11 PFAM
Pfam:Ras 23 102 4.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172074
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the RAB gene family which belongs to the RAS GTPase superfamily. The proteins in the family of RAS-related signaling molecules are small GTP-binding proteins that play important roles in the regulation of exocytotic and endocytotic pathways. This gene maps to the site of an ancestral telomere fusion event and may be a subtelomeric gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility, reduced testis weight, oligospermia, asthenozoospermia and short flagellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,046 Y533C probably damaging Het
Ahnak T C 19: 9,014,615 V4421A probably damaging Het
Bach1 A G 16: 87,719,285 K238R probably benign Het
Bloc1s6 T A 2: 122,738,657 V12D probably benign Het
Clca3b C A 3: 144,827,383 L629F probably benign Het
Clhc1 A G 11: 29,561,431 I292V probably benign Het
Col27a1 T C 4: 63,225,310 S412P probably damaging Het
Col6a4 A G 9: 106,072,198 I746T probably damaging Het
Cracr2a G A 6: 127,604,007 A49T probably damaging Het
Cyb561d1 A G 3: 108,200,692 I28T possibly damaging Het
Dnah11 T A 12: 117,883,617 M4264L probably damaging Het
Dnajc13 A G 9: 104,228,537 L412S probably damaging Het
Dpf3 T C 12: 83,325,011 N150S probably damaging Het
Epha2 T C 4: 141,323,494 C854R probably damaging Het
Fat2 G T 11: 55,310,681 Y522* probably null Het
Foxm1 A T 6: 128,373,388 S551C possibly damaging Het
Galnt12 T C 4: 47,104,150 V136A possibly damaging Het
Gm6647 T G 5: 13,768,821 noncoding transcript Het
Grin2b T A 6: 135,733,087 I1154F possibly damaging Het
Hmcn1 A G 1: 150,658,562 V2987A probably benign Het
Jade2 A G 11: 51,816,987 S800P probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr393 T C 11: 73,847,540 N195S probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plod1 T C 4: 147,918,781 E529G possibly damaging Het
Plppr2 T C 9: 21,947,615 C343R probably damaging Het
Prpf38a T C 4: 108,568,424 D219G probably damaging Het
Ptpra G A 2: 130,504,284 E122K probably benign Het
Reep1 A G 6: 71,761,374 M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,579,934 probably benign Het
Slc26a10 T C 10: 127,174,964 probably benign Het
Sun2 C A 15: 79,727,949 E510* probably null Het
Tanc1 A G 2: 59,834,707 probably null Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tor1aip1 G T 1: 156,007,488 H205N probably damaging Het
Trpc6 C T 9: 8,609,807 T92I probably benign Het
Vmn2r100 T A 17: 19,504,916 F36I probably benign Het
Zfp787 T C 7: 6,133,054 Y66C probably damaging Het
Other mutations in Rabl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Rabl2 APN 15 89590270 splice site probably benign
IGL01612:Rabl2 APN 15 89583412 missense probably benign 0.05
IGL02317:Rabl2 APN 15 89584289 missense probably damaging 1.00
R0335:Rabl2 UTSW 15 89583966 missense probably damaging 1.00
R4169:Rabl2 UTSW 15 89590379 start codon destroyed probably null 0.98
R4276:Rabl2 UTSW 15 89584188 intron probably benign
R4330:Rabl2 UTSW 15 89586934 missense probably benign 0.09
R6242:Rabl2 UTSW 15 89584352 missense probably benign
X0023:Rabl2 UTSW 15 89583980 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATTTCTGGCAGCAGCTCTGG -3'
(R):5'- AGACTGACCATTGGGAGTCG -3'

Sequencing Primer
(F):5'- CAGCAGCTCTGGGTTGTATG -3'
(R):5'- ACCATTGGGAGTCGCCAGTG -3'
Posted On2016-11-09