Incidental Mutation 'R5657:Bach1'
ID442401
Institutional Source Beutler Lab
Gene Symbol Bach1
Ensembl Gene ENSMUSG00000025612
Gene NameBTB and CNC homology 1, basic leucine zipper transcription factor 1
Synonyms
MMRRC Submission 043171-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5657 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location87698945-87733346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87719285 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 238 (K238R)
Ref Sequence ENSEMBL: ENSMUSP00000026703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026703]
PDB Structure
Structure of mouse Bach1 BTB domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000026703
AA Change: K238R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026703
Gene: ENSMUSG00000025612
AA Change: K238R

DomainStartEndE-ValueType
BTB 34 130 1.23e-24 SMART
Blast:BTB 153 235 2e-29 BLAST
low complexity region 378 390 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
BRLZ 556 622 1.2e-12 SMART
low complexity region 699 717 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156958
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that belongs to the cap'n'collar type of basic region leucine zipper factor family (CNC-bZip). The encoded protein contains broad complex, tramtrack, bric-a-brac/poxvirus and zinc finger (BTB/POZ) domains, which is atypical of CNC-bZip family members. These BTB/POZ domains facilitate protein-protein interactions and formation of homo- and/or hetero-oligomers. When this encoded protein forms a heterodimer with MafK, it functions as a repressor of Maf recognition element (MARE) and transcription is repressed. Multiple alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mice are healthy and fertile with no gross abnormalities but express elevated levels of HMOX1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,046 Y533C probably damaging Het
Ahnak T C 19: 9,014,615 V4421A probably damaging Het
Bloc1s6 T A 2: 122,738,657 V12D probably benign Het
Clca3b C A 3: 144,827,383 L629F probably benign Het
Clhc1 A G 11: 29,561,431 I292V probably benign Het
Col27a1 T C 4: 63,225,310 S412P probably damaging Het
Col6a4 A G 9: 106,072,198 I746T probably damaging Het
Cracr2a G A 6: 127,604,007 A49T probably damaging Het
Cyb561d1 A G 3: 108,200,692 I28T possibly damaging Het
Dnah11 T A 12: 117,883,617 M4264L probably damaging Het
Dnajc13 A G 9: 104,228,537 L412S probably damaging Het
Dpf3 T C 12: 83,325,011 N150S probably damaging Het
Epha2 T C 4: 141,323,494 C854R probably damaging Het
Fat2 G T 11: 55,310,681 Y522* probably null Het
Foxm1 A T 6: 128,373,388 S551C possibly damaging Het
Galnt12 T C 4: 47,104,150 V136A possibly damaging Het
Gm6647 T G 5: 13,768,821 noncoding transcript Het
Grin2b T A 6: 135,733,087 I1154F possibly damaging Het
Hmcn1 A G 1: 150,658,562 V2987A probably benign Het
Jade2 A G 11: 51,816,987 S800P probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr393 T C 11: 73,847,540 N195S probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plod1 T C 4: 147,918,781 E529G possibly damaging Het
Plppr2 T C 9: 21,947,615 C343R probably damaging Het
Prpf38a T C 4: 108,568,424 D219G probably damaging Het
Ptpra G A 2: 130,504,284 E122K probably benign Het
Rabl2 T C 15: 89,588,213 M38V probably benign Het
Reep1 A G 6: 71,761,374 M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,579,934 probably benign Het
Slc26a10 T C 10: 127,174,964 probably benign Het
Sun2 C A 15: 79,727,949 E510* probably null Het
Tanc1 A G 2: 59,834,707 probably null Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tor1aip1 G T 1: 156,007,488 H205N probably damaging Het
Trpc6 C T 9: 8,609,807 T92I probably benign Het
Vmn2r100 T A 17: 19,504,916 F36I probably benign Het
Zfp787 T C 7: 6,133,054 Y66C probably damaging Het
Other mutations in Bach1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01553:Bach1 APN 16 87722505 missense probably damaging 1.00
R0626:Bach1 UTSW 16 87729471 missense possibly damaging 0.94
R0701:Bach1 UTSW 16 87719989 missense probably damaging 0.99
R1070:Bach1 UTSW 16 87720121 missense probably benign 0.02
R1160:Bach1 UTSW 16 87715434 missense probably benign 0.34
R2066:Bach1 UTSW 16 87729625 missense probably damaging 0.99
R2235:Bach1 UTSW 16 87720113 missense probably damaging 1.00
R4716:Bach1 UTSW 16 87715379 start gained probably benign
R4801:Bach1 UTSW 16 87722452 missense probably damaging 0.99
R4802:Bach1 UTSW 16 87722452 missense probably damaging 0.99
R4989:Bach1 UTSW 16 87719000 missense possibly damaging 0.94
R5016:Bach1 UTSW 16 87719318 missense possibly damaging 0.88
R5527:Bach1 UTSW 16 87719545 missense probably benign 0.01
R6064:Bach1 UTSW 16 87729864 missense probably damaging 1.00
R6384:Bach1 UTSW 16 87719857 nonsense probably null
R7009:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7027:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7028:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7029:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7030:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7095:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7096:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7192:Bach1 UTSW 16 87729663 missense possibly damaging 0.71
R7385:Bach1 UTSW 16 87729497 missense probably damaging 0.99
R7571:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7572:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7623:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7632:Bach1 UTSW 16 87720143 missense probably benign 0.00
R7714:Bach1 UTSW 16 87718848 nonsense probably null
R7715:Bach1 UTSW 16 87719971 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AAACGTGTTCAGACGCCTCAG -3'
(R):5'- AATCCTGAGGCAAGGGTGTC -3'

Sequencing Primer
(F):5'- TGTTCAGACGCCTCAGTGTGAC -3'
(R):5'- CACTGAGGGGAGGGATCCTG -3'
Posted On2016-11-09