Incidental Mutation 'R5657:Vmn2r100'
ID442402
Institutional Source Beutler Lab
Gene Symbol Vmn2r100
Ensembl Gene ENSMUSG00000091859
Gene Namevomeronasal 2, receptor 100
SynonymsEG627537
MMRRC Submission 043171-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5657 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location19504732-19535231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19504916 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 36 (F36I)
Ref Sequence ENSEMBL: ENSMUSP00000156263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166081] [ENSMUST00000231465]
Predicted Effect probably benign
Transcript: ENSMUST00000166081
AA Change: F36I

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000128350
Gene: ENSMUSG00000091859
AA Change: F36I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 456 7.4e-41 PFAM
Pfam:NCD3G 510 563 1.9e-21 PFAM
Pfam:7tm_3 594 831 2.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231465
AA Change: F36I

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,046 Y533C probably damaging Het
Ahnak T C 19: 9,014,615 V4421A probably damaging Het
Bach1 A G 16: 87,719,285 K238R probably benign Het
Bloc1s6 T A 2: 122,738,657 V12D probably benign Het
Clca3b C A 3: 144,827,383 L629F probably benign Het
Clhc1 A G 11: 29,561,431 I292V probably benign Het
Col27a1 T C 4: 63,225,310 S412P probably damaging Het
Col6a4 A G 9: 106,072,198 I746T probably damaging Het
Cracr2a G A 6: 127,604,007 A49T probably damaging Het
Cyb561d1 A G 3: 108,200,692 I28T possibly damaging Het
Dnah11 T A 12: 117,883,617 M4264L probably damaging Het
Dnajc13 A G 9: 104,228,537 L412S probably damaging Het
Dpf3 T C 12: 83,325,011 N150S probably damaging Het
Epha2 T C 4: 141,323,494 C854R probably damaging Het
Fat2 G T 11: 55,310,681 Y522* probably null Het
Foxm1 A T 6: 128,373,388 S551C possibly damaging Het
Galnt12 T C 4: 47,104,150 V136A possibly damaging Het
Gm6647 T G 5: 13,768,821 noncoding transcript Het
Grin2b T A 6: 135,733,087 I1154F possibly damaging Het
Hmcn1 A G 1: 150,658,562 V2987A probably benign Het
Jade2 A G 11: 51,816,987 S800P probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr393 T C 11: 73,847,540 N195S probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plod1 T C 4: 147,918,781 E529G possibly damaging Het
Plppr2 T C 9: 21,947,615 C343R probably damaging Het
Prpf38a T C 4: 108,568,424 D219G probably damaging Het
Ptpra G A 2: 130,504,284 E122K probably benign Het
Rabl2 T C 15: 89,588,213 M38V probably benign Het
Reep1 A G 6: 71,761,374 M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,579,934 probably benign Het
Slc26a10 T C 10: 127,174,964 probably benign Het
Sun2 C A 15: 79,727,949 E510* probably null Het
Tanc1 A G 2: 59,834,707 probably null Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tor1aip1 G T 1: 156,007,488 H205N probably damaging Het
Trpc6 C T 9: 8,609,807 T92I probably benign Het
Zfp787 T C 7: 6,133,054 Y66C probably damaging Het
Other mutations in Vmn2r100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Vmn2r100 APN 17 19526000 missense probably damaging 1.00
IGL00912:Vmn2r100 APN 17 19531392 missense possibly damaging 0.95
IGL01107:Vmn2r100 APN 17 19521356 missense probably damaging 1.00
IGL01517:Vmn2r100 APN 17 19521963 missense probably benign 0.37
IGL01594:Vmn2r100 APN 17 19531233 missense possibly damaging 0.52
IGL01657:Vmn2r100 APN 17 19525916 missense possibly damaging 0.89
IGL01822:Vmn2r100 APN 17 19504838 missense probably null 0.00
IGL02020:Vmn2r100 APN 17 19504938 missense possibly damaging 0.78
IGL02060:Vmn2r100 APN 17 19521254 missense possibly damaging 0.79
IGL02126:Vmn2r100 APN 17 19521242 splice site probably benign
IGL02142:Vmn2r100 APN 17 19522321 missense probably damaging 1.00
IGL02308:Vmn2r100 APN 17 19521335 missense possibly damaging 0.90
IGL02407:Vmn2r100 APN 17 19521508 missense probably damaging 0.98
IGL02469:Vmn2r100 APN 17 19531285 nonsense probably null
IGL03088:Vmn2r100 APN 17 19522039 missense probably benign 0.27
IGL03181:Vmn2r100 APN 17 19531945 missense probably damaging 1.00
IGL03405:Vmn2r100 APN 17 19531924 missense probably damaging 1.00
H8562:Vmn2r100 UTSW 17 19521490 missense possibly damaging 0.87
R0012:Vmn2r100 UTSW 17 19504874 missense probably benign
R0012:Vmn2r100 UTSW 17 19526034 missense probably damaging 0.99
R0044:Vmn2r100 UTSW 17 19522179 missense possibly damaging 0.46
R0109:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0111:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0112:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0149:Vmn2r100 UTSW 17 19521247 critical splice acceptor site probably null
R0355:Vmn2r100 UTSW 17 19531320 missense probably benign 0.00
R0395:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0396:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0453:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0465:Vmn2r100 UTSW 17 19531530 missense probably damaging 0.98
R0477:Vmn2r100 UTSW 17 19522514 missense probably benign 0.00
R0510:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0512:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0514:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0518:Vmn2r100 UTSW 17 19521916 missense probably damaging 1.00
R0521:Vmn2r100 UTSW 17 19521916 missense probably damaging 1.00
R0555:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0608:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0959:Vmn2r100 UTSW 17 19523524 missense possibly damaging 0.95
R1114:Vmn2r100 UTSW 17 19531999 missense probably damaging 1.00
R2027:Vmn2r100 UTSW 17 19522072 missense probably benign 0.02
R2049:Vmn2r100 UTSW 17 19522050 missense probably benign 0.00
R2224:Vmn2r100 UTSW 17 19522372 missense probably benign 0.03
R2226:Vmn2r100 UTSW 17 19522372 missense probably benign 0.03
R3618:Vmn2r100 UTSW 17 19523430 missense probably benign
R3715:Vmn2r100 UTSW 17 19532010 missense probably damaging 0.99
R4120:Vmn2r100 UTSW 17 19531953 missense probably damaging 1.00
R4152:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4153:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4154:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4200:Vmn2r100 UTSW 17 19522535 missense probably benign 0.29
R4632:Vmn2r100 UTSW 17 19531954 missense probably damaging 1.00
R4720:Vmn2r100 UTSW 17 19522526 missense probably benign 0.02
R4761:Vmn2r100 UTSW 17 19521368 missense possibly damaging 0.47
R4831:Vmn2r100 UTSW 17 19521410 missense probably benign 0.28
R4951:Vmn2r100 UTSW 17 19532038 missense probably benign 0.01
R5211:Vmn2r100 UTSW 17 19525995 missense possibly damaging 0.67
R5553:Vmn2r100 UTSW 17 19504848 missense possibly damaging 0.64
R5883:Vmn2r100 UTSW 17 19523524 missense probably benign
R5912:Vmn2r100 UTSW 17 19531809 missense probably damaging 0.99
R6141:Vmn2r100 UTSW 17 19522314 missense probably benign 0.07
R6146:Vmn2r100 UTSW 17 19522260 missense probably benign 0.04
R6500:Vmn2r100 UTSW 17 19522093 missense probably damaging 1.00
R6575:Vmn2r100 UTSW 17 19521409 missense probably benign 0.12
R6647:Vmn2r100 UTSW 17 19522523 missense probably benign 0.00
R7038:Vmn2r100 UTSW 17 19505001 missense possibly damaging 0.76
R7052:Vmn2r100 UTSW 17 19531294 missense possibly damaging 0.95
R7170:Vmn2r100 UTSW 17 19531971 missense probably benign 0.00
R7209:Vmn2r100 UTSW 17 19531314 missense not run
R7312:Vmn2r100 UTSW 17 19522034 missense probably benign 0.01
R7734:Vmn2r100 UTSW 17 19522034 missense probably benign 0.01
R7750:Vmn2r100 UTSW 17 19522464 missense probably benign
R8103:Vmn2r100 UTSW 17 19531153 splice site probably null
R8193:Vmn2r100 UTSW 17 19504840 nonsense probably null
R8267:Vmn2r100 UTSW 17 19522490 nonsense probably null
R8290:Vmn2r100 UTSW 17 19531350 missense probably damaging 0.99
R8531:Vmn2r100 UTSW 17 19522197 missense possibly damaging 0.66
R8786:Vmn2r100 UTSW 17 19522576 missense probably damaging 1.00
X0062:Vmn2r100 UTSW 17 19531390 missense possibly damaging 0.89
Z1176:Vmn2r100 UTSW 17 19521530 missense probably benign 0.00
Z1177:Vmn2r100 UTSW 17 19504989 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAATGATTAGTGTGACTGACTGAG -3'
(R):5'- GACTACAGCCTCTAAGTCATGAG -3'

Sequencing Primer
(F):5'- GTACTGGACACTCTTCTGAAT -3'
(R):5'- GCCTCTAAGTCATGAGAATTCAGAC -3'
Posted On2016-11-09