Incidental Mutation 'R5668:Klra13-ps'
ID 442432
Institutional Source Beutler Lab
Gene Symbol Klra13-ps
Ensembl Gene ENSMUSG00000030178
Gene Name killer cell lectin-like receptor subfamily A, member 13, pseudogene
Synonyms Ly49M
MMRRC Submission 043311-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.133) question?
Stock # R5668 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 130268124-130283391 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to G at 130281246 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205252
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,603,975 (GRCm39) W429R probably damaging Het
Afg1l C T 10: 42,236,236 (GRCm39) C272Y probably damaging Het
Agrn T C 4: 156,251,770 (GRCm39) T1831A probably damaging Het
Aifm2 T C 10: 61,561,696 (GRCm39) V14A probably damaging Het
Angptl3 A T 4: 98,920,321 (GRCm39) probably null Het
Arfgap1 A T 2: 180,615,912 (GRCm39) D197V possibly damaging Het
Atp1a3 T C 7: 24,678,294 (GRCm39) probably benign Het
Brwd1 T C 16: 95,817,350 (GRCm39) I1387M probably damaging Het
Cavin4 A G 4: 48,672,499 (GRCm39) T315A probably benign Het
Cep128 T C 12: 90,966,410 (GRCm39) T1066A probably benign Het
Cln3 T C 7: 126,171,558 (GRCm39) T376A probably benign Het
Cntn4 A T 6: 106,656,397 (GRCm39) silent Het
Colec12 T A 18: 9,848,963 (GRCm39) D380E probably damaging Het
Csmd3 T C 15: 47,559,151 (GRCm39) I2371V possibly damaging Het
Cspg4b A G 13: 113,453,701 (GRCm39) S55G possibly damaging Het
Cxcl3 T C 5: 90,935,299 (GRCm39) S99P unknown Het
Ddx60 A G 8: 62,453,612 (GRCm39) R1244G probably benign Het
Dhx38 T C 8: 110,280,048 (GRCm39) D914G probably damaging Het
Dlc1 T G 8: 37,404,655 (GRCm39) probably benign Het
Eif4a3l1 A T 6: 136,306,393 (GRCm39) I264F probably benign Het
Fam161b A G 12: 84,403,124 (GRCm39) S169P probably damaging Het
Fastkd1 A G 2: 69,537,725 (GRCm39) S286P possibly damaging Het
Fmn2 A T 1: 174,409,603 (GRCm39) E612V unknown Het
Foxb1 T A 9: 69,667,528 (GRCm39) M1L probably damaging Het
Gm14412 A T 2: 177,007,402 (GRCm39) C164* probably null Het
Gm43302 T A 5: 105,423,678 (GRCm39) M432L probably benign Het
Gm4353 C A 7: 115,682,913 (GRCm39) A223S probably damaging Het
Gpatch8 T C 11: 102,391,693 (GRCm39) K143R unknown Het
Gpr15 A G 16: 58,538,013 (GRCm39) S359P probably damaging Het
Gucy2e A G 11: 69,119,207 (GRCm39) L649P probably damaging Het
H2-M10.5 C A 17: 37,085,473 (GRCm39) H211N probably damaging Het
Hs6st1 T C 1: 36,142,970 (GRCm39) Y302H probably damaging Het
Khdrbs2 A T 1: 32,506,851 (GRCm39) D165V probably damaging Het
Lrrc37 T A 11: 103,507,880 (GRCm39) probably benign Het
Lrrc37a T A 11: 103,391,001 (GRCm39) T1475S probably benign Het
Ly75 A G 2: 60,184,844 (GRCm39) S437P probably damaging Het
Maz C T 7: 126,624,494 (GRCm39) C342Y probably damaging Het
Mcf2l C A 8: 13,063,812 (GRCm39) S1008* probably null Het
Mcmbp T C 7: 128,314,478 (GRCm39) D246G probably benign Het
Mipol1 G A 12: 57,372,346 (GRCm39) R135H possibly damaging Het
Mycbp2 T A 14: 103,357,955 (GRCm39) Y4613F possibly damaging Het
Nup188 G A 2: 30,226,336 (GRCm39) A1118T probably damaging Het
Or10g6 A T 9: 39,933,964 (GRCm39) I92F probably damaging Het
Or2k2 T A 4: 58,785,489 (GRCm39) I78F probably benign Het
Or4a76 G A 2: 89,460,688 (GRCm39) L185F probably damaging Het
Or4c121 A T 2: 89,024,170 (GRCm39) D69E possibly damaging Het
Or4z4 A G 19: 12,076,290 (GRCm39) S238P probably damaging Het
Or51f1e A T 7: 102,747,103 (GRCm39) S52C probably benign Het
Or51h7 T C 7: 102,591,128 (GRCm39) K219E probably benign Het
P3h1 T A 4: 119,101,243 (GRCm39) I460N possibly damaging Het
Pcnt T C 10: 76,245,334 (GRCm39) D1101G probably benign Het
Phlpp2 C A 8: 110,655,205 (GRCm39) Q667K possibly damaging Het
Plec A G 15: 76,074,666 (GRCm39) F434L possibly damaging Het
Ppp6r2 T A 15: 89,164,602 (GRCm39) I602N probably damaging Het
Rdh8 A C 9: 20,736,475 (GRCm39) I181L probably benign Het
Rnf181 A G 6: 72,338,505 (GRCm39) M1T probably null Het
Rpl29-ps2 A G 13: 4,664,221 (GRCm39) noncoding transcript Het
Sart3 A G 5: 113,883,217 (GRCm39) probably null Het
Sec14l2 A C 11: 4,059,189 (GRCm39) L160R probably damaging Het
Senp1 C T 15: 97,946,236 (GRCm39) R503H probably damaging Het
Shoc1 A G 4: 59,047,399 (GRCm39) S1407P probably benign Het
Slc22a2 T C 17: 12,827,296 (GRCm39) V316A probably benign Het
Slc34a1 A T 13: 55,556,898 (GRCm39) I365F possibly damaging Het
Spag5 T C 11: 78,195,542 (GRCm39) V283A possibly damaging Het
Srebf2 C T 15: 82,076,456 (GRCm39) T702I probably benign Het
Sun3 A G 11: 8,981,433 (GRCm39) probably null Het
Syt6 A G 3: 103,528,217 (GRCm39) Y312C probably damaging Het
Tas2r121 T A 6: 132,677,756 (GRCm39) Y72F possibly damaging Het
Tfrc A G 16: 32,442,194 (GRCm39) Y473C probably damaging Het
Trp63 C T 16: 25,684,935 (GRCm39) A274V possibly damaging Het
Trpm5 T C 7: 142,626,966 (GRCm39) D1085G probably benign Het
Ttn A G 2: 76,745,008 (GRCm39) V5347A probably benign Het
Uqcc4 G A 17: 25,403,963 (GRCm39) S101N probably damaging Het
Vma21-ps T A 4: 52,496,946 (GRCm39) Q100L possibly damaging Het
Vmn2r22 T C 6: 123,614,873 (GRCm39) N239S probably benign Het
Wfdc8 T C 2: 164,439,339 (GRCm39) probably benign Het
Xkr4 T A 1: 3,741,258 (GRCm39) Y105F probably damaging Het
Xpo7 C T 14: 70,920,286 (GRCm39) V627I possibly damaging Het
Zfp606 T C 7: 12,226,479 (GRCm39) V200A probably benign Het
Zfp936 A T 7: 42,839,858 (GRCm39) S441C possibly damaging Het
Other mutations in Klra13-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2348:Klra13-ps UTSW 6 130,268,271 (GRCm39) splice site noncoding transcript
R4545:Klra13-ps UTSW 6 130,268,232 (GRCm39) exon noncoding transcript
R4633:Klra13-ps UTSW 6 130,268,136 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TATCACCGAGTCCTCAGAAGGG -3'
(R):5'- GTCAGTTCATATGATAGACTTGTGC -3'

Sequencing Primer
(F):5'- CAGAACACTGCATTTTGTCAGG -3'
(R):5'- GACTTGTGCAAAATTTTCCCTTG -3'
Posted On 2016-11-09