Incidental Mutation 'R5668:Zfp606'
ID442435
Institutional Source Beutler Lab
Gene Symbol Zfp606
Ensembl Gene ENSMUSG00000030386
Gene Namezinc finger protein 606
Synonyms2410022M24Rik
MMRRC Submission 043311-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5668 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12478293-12496235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12492552 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 200 (V200A)
Ref Sequence ENSEMBL: ENSMUSP00000096421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098822] [ENSMUST00000151933] [ENSMUST00000209403]
Predicted Effect probably benign
Transcript: ENSMUST00000098822
AA Change: V200A

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000096421
Gene: ENSMUSG00000030386
AA Change: V200A

DomainStartEndE-ValueType
KRAB 63 123 3.36e-39 SMART
ZnF_C2H2 291 313 1.83e2 SMART
ZnF_C2H2 403 425 2.89e1 SMART
ZnF_C2H2 431 453 2.3e-5 SMART
ZnF_C2H2 459 481 1.28e-3 SMART
ZnF_C2H2 487 509 3.95e-4 SMART
ZnF_C2H2 515 537 5.67e-5 SMART
ZnF_C2H2 543 565 6.88e-4 SMART
ZnF_C2H2 571 593 9.22e-5 SMART
ZnF_C2H2 599 621 1.95e-3 SMART
ZnF_C2H2 627 649 1.47e-3 SMART
ZnF_C2H2 655 677 3.39e-3 SMART
ZnF_C2H2 683 705 4.11e-2 SMART
ZnF_C2H2 711 733 4.87e-4 SMART
ZnF_C2H2 739 761 1.67e-2 SMART
ZnF_C2H2 767 789 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133515
Predicted Effect probably benign
Transcript: ENSMUST00000151933
SMART Domains Protein: ENSMUSP00000122197
Gene: ENSMUSG00000030386

DomainStartEndE-ValueType
KRAB 5 65 3.36e-39 SMART
ZnF_C2H2 233 255 1.83e2 SMART
ZnF_C2H2 345 367 2.89e1 SMART
ZnF_C2H2 373 395 2.3e-5 SMART
ZnF_C2H2 401 423 1.28e-3 SMART
ZnF_C2H2 429 451 3.95e-4 SMART
ZnF_C2H2 457 479 5.67e-5 SMART
ZnF_C2H2 485 507 6.88e-4 SMART
ZnF_C2H2 513 535 9.22e-5 SMART
ZnF_C2H2 541 563 1.95e-3 SMART
ZnF_C2H2 569 591 1.47e-3 SMART
ZnF_C2H2 597 619 3.39e-3 SMART
ZnF_C2H2 625 647 4.11e-2 SMART
ZnF_C2H2 653 675 4.87e-4 SMART
ZnF_C2H2 681 703 1.67e-2 SMART
ZnF_C2H2 709 731 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209403
AA Change: V142A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.0620 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein containing a Kruppel-associated box (KRAB) domain at its N-terminus, followed by contiguous C2H2 zinc finger motifs. The encoded protein is a nuclear protein that can act as a transcriptional repressor of growth factor-mediated signaling pathways in a reporter gene assay. This protein has been shown to interact with the SRY-box 9 gene product, and suppresses its transcriptional activity by inhibiting its DNA binding activity. Reduced expression of this gene promotes chondrocyte differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,904,550 W429R probably damaging Het
Afg1l C T 10: 42,360,240 C272Y probably damaging Het
Agrn T C 4: 156,167,313 T1831A probably damaging Het
AI481877 A G 4: 59,047,399 S1407P probably benign Het
Aifm2 T C 10: 61,725,917 V14A probably damaging Het
Angptl3 A T 4: 99,032,084 probably null Het
Arfgap1 A T 2: 180,974,119 D197V possibly damaging Het
Atp1a3 T C 7: 24,978,869 probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC067074 A G 13: 113,317,167 S55G possibly damaging Het
Brwd1 T C 16: 96,016,150 I1387M probably damaging Het
Cavin4 A G 4: 48,672,499 T315A probably benign Het
Cep128 T C 12: 90,999,636 T1066A probably benign Het
Cln3 T C 7: 126,572,386 T376A probably benign Het
Cntn4 A T 6: 106,679,436 silent Het
Colec12 T A 18: 9,848,963 D380E probably damaging Het
Csmd3 T C 15: 47,695,755 I2371V possibly damaging Het
Cxcl3 T C 5: 90,787,440 S99P unknown Het
Ddx60 A G 8: 62,000,578 R1244G probably benign Het
Dhx38 T C 8: 109,553,416 D914G probably damaging Het
Dlc1 T G 8: 36,937,501 probably benign Het
Fam161b A G 12: 84,356,350 S169P probably damaging Het
Fastkd1 A G 2: 69,707,381 S286P possibly damaging Het
Fmn2 A T 1: 174,582,037 E612V unknown Het
Foxb1 T A 9: 69,760,246 M1L probably damaging Het
Gm14412 A T 2: 177,315,609 C164* probably null Het
Gm43302 T A 5: 105,275,812 M432L probably benign Het
Gm4353 C A 7: 116,083,678 A223S probably damaging Het
Gm884 T A 11: 103,617,054 probably benign Het
Gm8994 A T 6: 136,329,395 I264F probably benign Het
Gpatch8 T C 11: 102,500,867 K143R unknown Het
Gpr15 A G 16: 58,717,650 S359P probably damaging Het
Gucy2e A G 11: 69,228,381 L649P probably damaging Het
H2-M10.5 C A 17: 36,774,581 H211N probably damaging Het
Hs6st1 T C 1: 36,103,889 Y302H probably damaging Het
Khdrbs2 A T 1: 32,467,770 D165V probably damaging Het
Klra13-ps T G 6: 130,304,283 noncoding transcript Het
Lrrc37a T A 11: 103,500,175 T1475S probably benign Het
Ly75 A G 2: 60,354,500 S437P probably damaging Het
Maz C T 7: 127,025,322 C342Y probably damaging Het
Mcf2l C A 8: 13,013,812 S1008* probably null Het
Mcmbp T C 7: 128,712,754 D246G probably benign Het
Mipol1 G A 12: 57,325,560 R135H possibly damaging Het
Mycbp2 T A 14: 103,120,519 Y4613F possibly damaging Het
Nup188 G A 2: 30,336,324 A1118T probably damaging Het
Olfr1226 A T 2: 89,193,826 D69E possibly damaging Het
Olfr1249 G A 2: 89,630,344 L185F probably damaging Het
Olfr1427 A G 19: 12,098,926 S238P probably damaging Het
Olfr267 T A 4: 58,785,489 I78F probably benign Het
Olfr573-ps1 T C 7: 102,941,921 K219E probably benign Het
Olfr585 A T 7: 103,097,896 S52C probably benign Het
Olfr981 A T 9: 40,022,668 I92F probably damaging Het
P3h1 T A 4: 119,244,046 I460N possibly damaging Het
Pcnt T C 10: 76,409,500 D1101G probably benign Het
Phlpp2 C A 8: 109,928,573 Q667K possibly damaging Het
Plec A G 15: 76,190,466 F434L possibly damaging Het
Ppp6r2 T A 15: 89,280,399 I602N probably damaging Het
Rdh8 A C 9: 20,825,179 I181L probably benign Het
Rnf181 A G 6: 72,361,522 M1T probably null Het
Rpl29-ps2 A G 13: 4,614,222 noncoding transcript Het
Sart3 A G 5: 113,745,156 probably null Het
Sec14l2 A C 11: 4,109,189 L160R probably damaging Het
Senp1 C T 15: 98,048,355 R503H probably damaging Het
Slc22a2 T C 17: 12,608,409 V316A probably benign Het
Slc34a1 A T 13: 55,409,085 I365F possibly damaging Het
Spag5 T C 11: 78,304,716 V283A possibly damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Sun3 A G 11: 9,031,433 probably null Het
Syt6 A G 3: 103,620,901 Y312C probably damaging Het
Tas2r121 T A 6: 132,700,793 Y72F possibly damaging Het
Tfrc A G 16: 32,623,376 Y473C probably damaging Het
Trp63 C T 16: 25,866,185 A274V possibly damaging Het
Trpm5 T C 7: 143,073,229 D1085G probably benign Het
Ttn A G 2: 76,914,664 V5347A probably benign Het
Vma21-ps T A 4: 52,496,946 Q100L possibly damaging Het
Vmn2r22 T C 6: 123,637,914 N239S probably benign Het
Wfdc8 T C 2: 164,597,419 probably benign Het
Xkr4 T A 1: 3,671,035 Y105F probably damaging Het
Xpo7 C T 14: 70,682,846 V627I possibly damaging Het
Zfp936 A T 7: 43,190,434 S441C possibly damaging Het
Other mutations in Zfp606
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1680:Zfp606 UTSW 7 12493971 missense probably damaging 1.00
R1861:Zfp606 UTSW 7 12480931 unclassified probably benign
R1943:Zfp606 UTSW 7 12493688 missense probably damaging 1.00
R2142:Zfp606 UTSW 7 12479726 missense probably damaging 0.99
R2340:Zfp606 UTSW 7 12493089 missense possibly damaging 0.91
R3426:Zfp606 UTSW 7 12489664 missense probably damaging 0.99
R4208:Zfp606 UTSW 7 12494175 missense probably damaging 1.00
R4258:Zfp606 UTSW 7 12494340 unclassified probably null
R4383:Zfp606 UTSW 7 12494001 missense probably damaging 1.00
R4393:Zfp606 UTSW 7 12492849 missense probably damaging 1.00
R4782:Zfp606 UTSW 7 12494005 missense probably damaging 1.00
R4858:Zfp606 UTSW 7 12493056 missense possibly damaging 0.89
R5704:Zfp606 UTSW 7 12493529 missense probably damaging 0.99
R6064:Zfp606 UTSW 7 12481033 missense possibly damaging 0.82
R6080:Zfp606 UTSW 7 12494116 missense probably damaging 1.00
R6190:Zfp606 UTSW 7 12494001 missense probably damaging 1.00
R6383:Zfp606 UTSW 7 12492944 missense probably benign 0.18
R6964:Zfp606 UTSW 7 12489592 missense probably damaging 1.00
R7193:Zfp606 UTSW 7 12494039 missense probably benign 0.32
R7507:Zfp606 UTSW 7 12492941 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CCCTTCTGTTTCAGAGTGGATG -3'
(R):5'- GCAGGGTATACAGGCTGAAC -3'

Sequencing Primer
(F):5'- CTGTTTCAGAGTGGATGAGGAATAC -3'
(R):5'- ACCTTATCTGCATACATTATGGCTG -3'
Posted On2016-11-09