Mutagenetix > Incidental Mutation

Incidental Mutation 'R5668:Olfr585'

442440

Institutional Source

Beutler Lab

Gene Symbol

Olfr585

Ensembl Gene

ENSMUSG00000078080

Gene Name

olfactory receptor 585

Synonyms

MOR14-4, GA_x6K02T2PBJ9-5809085-5810035

MMRRC Submission

043311-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R5668 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103097720-103098749 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 103097896 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 52 (S52C)

Ref Sequence

ENSEMBL: ENSMUSP00000100476 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000104881]

AlphaFold

E9PXW4

Predicted Effect

probably benign
Transcript: ENSMUST00000104881
AA Change: S52C

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000100476
Gene: ENSMUSG00000078080
AA Change: S52C

Domain	Start	End	E-Value	Type
Pfam:7tm_4	40	318	1.3e-109	PFAM
Pfam:7TM_GPCR_Srsx	45	315	5.9e-6	PFAM
Pfam:7tm_1	50	300	7.9e-23	PFAM

Meta Mutation Damage Score

0.1229

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn4	A	G	7: 28,904,550	W429R	probably damaging	Het
Afg1l	C	T	10: 42,360,240	C272Y	probably damaging	Het
Agrn	T	C	4: 156,167,313	T1831A	probably damaging	Het
AI481877	A	G	4: 59,047,399	S1407P	probably benign	Het
Aifm2	T	C	10: 61,725,917	V14A	probably damaging	Het
Angptl3	A	T	4: 99,032,084		probably null	Het
Arfgap1	A	T	2: 180,974,119	D197V	possibly damaging	Het
Atp1a3	T	C	7: 24,978,869		probably benign	Het
BC003965	G	A	17: 25,184,989	S101N	probably damaging	Het
BC067074	A	G	13: 113,317,167	S55G	possibly damaging	Het
Brwd1	T	C	16: 96,016,150	I1387M	probably damaging	Het
Cavin4	A	G	4: 48,672,499	T315A	probably benign	Het
Cep128	T	C	12: 90,999,636	T1066A	probably benign	Het
Cln3	T	C	7: 126,572,386	T376A	probably benign	Het
Cntn4	A	T	6: 106,679,436		silent	Het
Colec12	T	A	18: 9,848,963	D380E	probably damaging	Het
Csmd3	T	C	15: 47,695,755	I2371V	possibly damaging	Het
Cxcl3	T	C	5: 90,787,440	S99P	unknown	Het
Ddx60	A	G	8: 62,000,578	R1244G	probably benign	Het
Dhx38	T	C	8: 109,553,416	D914G	probably damaging	Het
Dlc1	T	G	8: 36,937,501		probably benign	Het
Fam161b	A	G	12: 84,356,350	S169P	probably damaging	Het
Fastkd1	A	G	2: 69,707,381	S286P	possibly damaging	Het
Fmn2	A	T	1: 174,582,037	E612V	unknown	Het
Foxb1	T	A	9: 69,760,246	M1L	probably damaging	Het
Gm14412	A	T	2: 177,315,609	C164*	probably null	Het
Gm43302	T	A	5: 105,275,812	M432L	probably benign	Het
Gm4353	C	A	7: 116,083,678	A223S	probably damaging	Het
Gm884	T	A	11: 103,617,054		probably benign	Het
Gm8994	A	T	6: 136,329,395	I264F	probably benign	Het
Gpatch8	T	C	11: 102,500,867	K143R	unknown	Het
Gpr15	A	G	16: 58,717,650	S359P	probably damaging	Het
Gucy2e	A	G	11: 69,228,381	L649P	probably damaging	Het
H2-M10.5	C	A	17: 36,774,581	H211N	probably damaging	Het
Hs6st1	T	C	1: 36,103,889	Y302H	probably damaging	Het
Khdrbs2	A	T	1: 32,467,770	D165V	probably damaging	Het
Klra13-ps	T	G	6: 130,304,283		noncoding transcript	Het
Lrrc37a	T	A	11: 103,500,175	T1475S	probably benign	Het
Ly75	A	G	2: 60,354,500	S437P	probably damaging	Het
Maz	C	T	7: 127,025,322	C342Y	probably damaging	Het
Mcf2l	C	A	8: 13,013,812	S1008*	probably null	Het
Mcmbp	T	C	7: 128,712,754	D246G	probably benign	Het
Mipol1	G	A	12: 57,325,560	R135H	possibly damaging	Het
Mycbp2	T	A	14: 103,120,519	Y4613F	possibly damaging	Het
Nup188	G	A	2: 30,336,324	A1118T	probably damaging	Het
Olfr1226	A	T	2: 89,193,826	D69E	possibly damaging	Het
Olfr1249	G	A	2: 89,630,344	L185F	probably damaging	Het
Olfr1427	A	G	19: 12,098,926	S238P	probably damaging	Het
Olfr267	T	A	4: 58,785,489	I78F	probably benign	Het
Olfr573-ps1	T	C	7: 102,941,921	K219E	probably benign	Het
Olfr981	A	T	9: 40,022,668	I92F	probably damaging	Het
P3h1	T	A	4: 119,244,046	I460N	possibly damaging	Het
Pcnt	T	C	10: 76,409,500	D1101G	probably benign	Het
Phlpp2	C	A	8: 109,928,573	Q667K	possibly damaging	Het
Plec	A	G	15: 76,190,466	F434L	possibly damaging	Het
Ppp6r2	T	A	15: 89,280,399	I602N	probably damaging	Het
Rdh8	A	C	9: 20,825,179	I181L	probably benign	Het
Rnf181	A	G	6: 72,361,522	M1T	probably null	Het
Rpl29-ps2	A	G	13: 4,614,222		noncoding transcript	Het
Sart3	A	G	5: 113,745,156		probably null	Het
Sec14l2	A	C	11: 4,109,189	L160R	probably damaging	Het
Senp1	C	T	15: 98,048,355	R503H	probably damaging	Het
Slc22a2	T	C	17: 12,608,409	V316A	probably benign	Het
Slc34a1	A	T	13: 55,409,085	I365F	possibly damaging	Het
Spag5	T	C	11: 78,304,716	V283A	possibly damaging	Het
Srebf2	C	T	15: 82,192,255	T702I	probably benign	Het
Sun3	A	G	11: 9,031,433		probably null	Het
Syt6	A	G	3: 103,620,901	Y312C	probably damaging	Het
Tas2r121	T	A	6: 132,700,793	Y72F	possibly damaging	Het
Tfrc	A	G	16: 32,623,376	Y473C	probably damaging	Het
Trp63	C	T	16: 25,866,185	A274V	possibly damaging	Het
Trpm5	T	C	7: 143,073,229	D1085G	probably benign	Het
Ttn	A	G	2: 76,914,664	V5347A	probably benign	Het
Vma21-ps	T	A	4: 52,496,946	Q100L	possibly damaging	Het
Vmn2r22	T	C	6: 123,637,914	N239S	probably benign	Het
Wfdc8	T	C	2: 164,597,419		probably benign	Het
Xkr4	T	A	1: 3,671,035	Y105F	probably damaging	Het
Xpo7	C	T	14: 70,682,846	V627I	possibly damaging	Het
Zfp606	T	C	7: 12,492,552	V200A	probably benign	Het
Zfp936	A	T	7: 43,190,434	S441C	possibly damaging	Het

Other mutations in Olfr585

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01022:Olfr585	APN	7	103097870	missense	probably damaging	1.00
IGL02866:Olfr585	APN	7	103098383	missense	probably damaging	0.99
FR4548:Olfr585	UTSW	7	103098309	nonsense	probably null
FR4976:Olfr585	UTSW	7	103098309	small insertion	probably benign
R0893:Olfr585	UTSW	7	103098434	missense	probably benign	0.01
R0926:Olfr585	UTSW	7	103097885	missense	probably damaging	1.00
R1486:Olfr585	UTSW	7	103098430	missense	probably damaging	1.00
R2031:Olfr585	UTSW	7	103098164	missense	probably damaging	0.98
R3852:Olfr585	UTSW	7	103098184	missense	probably damaging	0.97
R4849:Olfr585	UTSW	7	103098319	missense	possibly damaging	0.95
R5241:Olfr585	UTSW	7	103098317	missense	probably benign	0.36
R5841:Olfr585	UTSW	7	103097954	missense	probably damaging	1.00
R6902:Olfr585	UTSW	7	103098355	missense	probably benign	0.12
R7943:Olfr585	UTSW	7	103097946	missense	probably damaging	0.98
R8265:Olfr585	UTSW	7	103098097	missense	probably benign	0.00
R8969:Olfr585	UTSW	7	103098044	missense	probably damaging	0.99
R9345:Olfr585	UTSW	7	103098506	missense	possibly damaging	0.93
R9376:Olfr585	UTSW	7	103097764	missense	probably benign	0.01
R9702:Olfr585	UTSW	7	103098136	missense	probably damaging	0.99
RF003:Olfr585	UTSW	7	103098305
RF003:Olfr585	UTSW	7	103098306	nonsense	probably null
RF004:Olfr585	UTSW	7	103098305
RF004:Olfr585	UTSW	7	103098308	small insertion	probably benign
RF004:Olfr585	UTSW	7	103098309	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCACAGTAAAGGCAAATGCTAC -3'
(R):5'- TGCAGATCGCTACATAACGATC -3'

Sequencing Primer
(F):5'- GCAAATGCTACAAATGCAGGAC -3'
(R):5'- TCTGTACATGTGAACCCATGGAG -3'

Posted On

2016-11-09