Mutagenetix > Incidental Mutation

Incidental Mutation 'R5668:Spag5'

442459

Institutional Source

Beutler Lab

Gene Symbol

Spag5

Ensembl Gene

ENSMUSG00000002055

Gene Name

sperm associated antigen 5

Synonyms

D11Bhm180e, Astrin, MAP126, Deepest, Mastrin, S17, s17

MMRRC Submission

043311-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5668 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78301529-78322457 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 78304716 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 283 (V283A)

Ref Sequence

ENSEMBL: ENSMUSP00000045286 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045026]

AlphaFold

Q7TME2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045026
AA Change: V283A

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055
AA Change: V283A

Domain	Start	End	E-Value	Type
low complexity region	405	420	N/A	INTRINSIC
low complexity region	477	493	N/A	INTRINSIC
coiled coil region	514	547	N/A	INTRINSIC
coiled coil region	638	700	N/A	INTRINSIC
coiled coil region	743	854	N/A	INTRINSIC
low complexity region	898	912	N/A	INTRINSIC
coiled coil region	970	1006	N/A	INTRINSIC
coiled coil region	1032	1068	N/A	INTRINSIC
coiled coil region	1104	1140	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133579

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146068

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with normal breeding and mating behavio; no abnormalities in male reproductive system anatomy or histology or in spermatogenesis were detectable. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn4	A	G	7: 28,904,550	W429R	probably damaging	Het
Afg1l	C	T	10: 42,360,240	C272Y	probably damaging	Het
Agrn	T	C	4: 156,167,313	T1831A	probably damaging	Het
AI481877	A	G	4: 59,047,399	S1407P	probably benign	Het
Aifm2	T	C	10: 61,725,917	V14A	probably damaging	Het
Angptl3	A	T	4: 99,032,084		probably null	Het
Arfgap1	A	T	2: 180,974,119	D197V	possibly damaging	Het
Atp1a3	T	C	7: 24,978,869		probably benign	Het
BC003965	G	A	17: 25,184,989	S101N	probably damaging	Het
BC067074	A	G	13: 113,317,167	S55G	possibly damaging	Het
Brwd1	T	C	16: 96,016,150	I1387M	probably damaging	Het
Cavin4	A	G	4: 48,672,499	T315A	probably benign	Het
Cep128	T	C	12: 90,999,636	T1066A	probably benign	Het
Cln3	T	C	7: 126,572,386	T376A	probably benign	Het
Cntn4	A	T	6: 106,679,436		silent	Het
Colec12	T	A	18: 9,848,963	D380E	probably damaging	Het
Csmd3	T	C	15: 47,695,755	I2371V	possibly damaging	Het
Cxcl3	T	C	5: 90,787,440	S99P	unknown	Het
Ddx60	A	G	8: 62,000,578	R1244G	probably benign	Het
Dhx38	T	C	8: 109,553,416	D914G	probably damaging	Het
Dlc1	T	G	8: 36,937,501		probably benign	Het
Fam161b	A	G	12: 84,356,350	S169P	probably damaging	Het
Fastkd1	A	G	2: 69,707,381	S286P	possibly damaging	Het
Fmn2	A	T	1: 174,582,037	E612V	unknown	Het
Foxb1	T	A	9: 69,760,246	M1L	probably damaging	Het
Gm14412	A	T	2: 177,315,609	C164*	probably null	Het
Gm43302	T	A	5: 105,275,812	M432L	probably benign	Het
Gm4353	C	A	7: 116,083,678	A223S	probably damaging	Het
Gm884	T	A	11: 103,617,054		probably benign	Het
Gm8994	A	T	6: 136,329,395	I264F	probably benign	Het
Gpatch8	T	C	11: 102,500,867	K143R	unknown	Het
Gpr15	A	G	16: 58,717,650	S359P	probably damaging	Het
Gucy2e	A	G	11: 69,228,381	L649P	probably damaging	Het
H2-M10.5	C	A	17: 36,774,581	H211N	probably damaging	Het
Hs6st1	T	C	1: 36,103,889	Y302H	probably damaging	Het
Khdrbs2	A	T	1: 32,467,770	D165V	probably damaging	Het
Klra13-ps	T	G	6: 130,304,283		noncoding transcript	Het
Lrrc37a	T	A	11: 103,500,175	T1475S	probably benign	Het
Ly75	A	G	2: 60,354,500	S437P	probably damaging	Het
Maz	C	T	7: 127,025,322	C342Y	probably damaging	Het
Mcf2l	C	A	8: 13,013,812	S1008*	probably null	Het
Mcmbp	T	C	7: 128,712,754	D246G	probably benign	Het
Mipol1	G	A	12: 57,325,560	R135H	possibly damaging	Het
Mycbp2	T	A	14: 103,120,519	Y4613F	possibly damaging	Het
Nup188	G	A	2: 30,336,324	A1118T	probably damaging	Het
Olfr1226	A	T	2: 89,193,826	D69E	possibly damaging	Het
Olfr1249	G	A	2: 89,630,344	L185F	probably damaging	Het
Olfr1427	A	G	19: 12,098,926	S238P	probably damaging	Het
Olfr267	T	A	4: 58,785,489	I78F	probably benign	Het
Olfr573-ps1	T	C	7: 102,941,921	K219E	probably benign	Het
Olfr585	A	T	7: 103,097,896	S52C	probably benign	Het
Olfr981	A	T	9: 40,022,668	I92F	probably damaging	Het
P3h1	T	A	4: 119,244,046	I460N	possibly damaging	Het
Pcnt	T	C	10: 76,409,500	D1101G	probably benign	Het
Phlpp2	C	A	8: 109,928,573	Q667K	possibly damaging	Het
Plec	A	G	15: 76,190,466	F434L	possibly damaging	Het
Ppp6r2	T	A	15: 89,280,399	I602N	probably damaging	Het
Rdh8	A	C	9: 20,825,179	I181L	probably benign	Het
Rnf181	A	G	6: 72,361,522	M1T	probably null	Het
Rpl29-ps2	A	G	13: 4,614,222		noncoding transcript	Het
Sart3	A	G	5: 113,745,156		probably null	Het
Sec14l2	A	C	11: 4,109,189	L160R	probably damaging	Het
Senp1	C	T	15: 98,048,355	R503H	probably damaging	Het
Slc22a2	T	C	17: 12,608,409	V316A	probably benign	Het
Slc34a1	A	T	13: 55,409,085	I365F	possibly damaging	Het
Srebf2	C	T	15: 82,192,255	T702I	probably benign	Het
Sun3	A	G	11: 9,031,433		probably null	Het
Syt6	A	G	3: 103,620,901	Y312C	probably damaging	Het
Tas2r121	T	A	6: 132,700,793	Y72F	possibly damaging	Het
Tfrc	A	G	16: 32,623,376	Y473C	probably damaging	Het
Trp63	C	T	16: 25,866,185	A274V	possibly damaging	Het
Trpm5	T	C	7: 143,073,229	D1085G	probably benign	Het
Ttn	A	G	2: 76,914,664	V5347A	probably benign	Het
Vma21-ps	T	A	4: 52,496,946	Q100L	possibly damaging	Het
Vmn2r22	T	C	6: 123,637,914	N239S	probably benign	Het
Wfdc8	T	C	2: 164,597,419		probably benign	Het
Xkr4	T	A	1: 3,671,035	Y105F	probably damaging	Het
Xpo7	C	T	14: 70,682,846	V627I	possibly damaging	Het
Zfp606	T	C	7: 12,492,552	V200A	probably benign	Het
Zfp936	A	T	7: 43,190,434	S441C	possibly damaging	Het

Other mutations in Spag5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01380:Spag5	APN	11	78304617	missense	possibly damaging	0.62
IGL01820:Spag5	APN	11	78304259	missense	probably benign	0.06
IGL02066:Spag5	APN	11	78304532	missense	probably benign
IGL02140:Spag5	APN	11	78315633	missense	possibly damaging	0.62
IGL02251:Spag5	APN	11	78320034	missense	probably damaging	1.00
IGL02452:Spag5	APN	11	78304623	missense	probably benign	0.08
IGL02658:Spag5	APN	11	78321331	nonsense	probably null
boyardee	UTSW	11	78313191	critical splice donor site	probably null
Franco	UTSW	11	78314182	nonsense	probably null
spaghetto	UTSW	11	78313379	nonsense	probably null
IGL02991:Spag5	UTSW	11	78314251	missense	probably damaging	0.99
R0477:Spag5	UTSW	11	78314198	missense	probably damaging	1.00
R0512:Spag5	UTSW	11	78319586	unclassified	probably benign
R0535:Spag5	UTSW	11	78304728	missense	probably benign	0.00
R0557:Spag5	UTSW	11	78314211	missense	probably damaging	0.99
R0584:Spag5	UTSW	11	78304095	missense	possibly damaging	0.49
R0666:Spag5	UTSW	11	78313396	missense	probably damaging	1.00
R0723:Spag5	UTSW	11	78319584	unclassified	probably benign
R1413:Spag5	UTSW	11	78305317	nonsense	probably null
R1680:Spag5	UTSW	11	78320616	missense	probably damaging	1.00
R1687:Spag5	UTSW	11	78304929	missense	probably benign	0.32
R1696:Spag5	UTSW	11	78321326	missense	probably damaging	1.00
R1831:Spag5	UTSW	11	78314256	missense	probably benign	0.08
R1866:Spag5	UTSW	11	78304455	missense	possibly damaging	0.62
R1918:Spag5	UTSW	11	78304176	missense	probably benign	0.01
R4004:Spag5	UTSW	11	78321529	missense	probably benign	0.22
R4005:Spag5	UTSW	11	78321529	missense	probably benign	0.22
R4222:Spag5	UTSW	11	78304511	missense	probably damaging	1.00
R4750:Spag5	UTSW	11	78320052	missense	probably benign	0.00
R4771:Spag5	UTSW	11	78304766	missense	probably damaging	1.00
R4928:Spag5	UTSW	11	78314373	missense	probably damaging	0.97
R5360:Spag5	UTSW	11	78314762	missense	probably damaging	0.99
R5366:Spag5	UTSW	11	78320326	splice site	probably null
R5618:Spag5	UTSW	11	78304080	missense	probably benign	0.00
R5762:Spag5	UTSW	11	78304146	missense	probably benign	0.25
R5859:Spag5	UTSW	11	78313534	missense	probably benign	0.38
R6564:Spag5	UTSW	11	78315575	missense	probably damaging	1.00
R6571:Spag5	UTSW	11	78321269	missense	probably damaging	1.00
R6573:Spag5	UTSW	11	78314182	nonsense	probably null
R7074:Spag5	UTSW	11	78305042	critical splice donor site	probably null
R7091:Spag5	UTSW	11	78313191	critical splice donor site	probably null
R7332:Spag5	UTSW	11	78313379	nonsense	probably null
R8073:Spag5	UTSW	11	78301977	missense	probably benign	0.22
R8709:Spag5	UTSW	11	78301912	missense	probably benign
R8723:Spag5	UTSW	11	78321389	missense	probably damaging	1.00
R8976:Spag5	UTSW	11	78304587	missense	probably benign	0.01
R9053:Spag5	UTSW	11	78321749	missense	probably benign	0.14
R9142:Spag5	UTSW	11	78301997	missense	possibly damaging	0.56
Z1176:Spag5	UTSW	11	78314982	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- ACACTGAAGATGCACCTGTG -3'
(R):5'- AGGTTTTGTAGCATGACCGATG -3'

Sequencing Primer
(F):5'- AAGATGCACCTGTGGACTTAGTTCC -3'
(R):5'- GTAGCATGACCGATGTATTCACAC -3'

Posted On

2016-11-09