Incidental Mutation 'R5668:Spag5'
ID 442459
Institutional Source Beutler Lab
Gene Symbol Spag5
Ensembl Gene ENSMUSG00000002055
Gene Name sperm associated antigen 5
Synonyms s17, Astrin, Mastrin, MAP126, Deepest, D11Bhm180e, S17
MMRRC Submission 043311-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5668 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 78192412-78213283 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78195542 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 283 (V283A)
Ref Sequence ENSEMBL: ENSMUSP00000045286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045026]
AlphaFold Q7TME2
Predicted Effect possibly damaging
Transcript: ENSMUST00000045026
AA Change: V283A

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055
AA Change: V283A

DomainStartEndE-ValueType
low complexity region 405 420 N/A INTRINSIC
low complexity region 477 493 N/A INTRINSIC
coiled coil region 514 547 N/A INTRINSIC
coiled coil region 638 700 N/A INTRINSIC
coiled coil region 743 854 N/A INTRINSIC
low complexity region 898 912 N/A INTRINSIC
coiled coil region 970 1006 N/A INTRINSIC
coiled coil region 1032 1068 N/A INTRINSIC
coiled coil region 1104 1140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146068
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with normal breeding and mating behavio; no abnormalities in male reproductive system anatomy or histology or in spermatogenesis were detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,603,975 (GRCm39) W429R probably damaging Het
Afg1l C T 10: 42,236,236 (GRCm39) C272Y probably damaging Het
Agrn T C 4: 156,251,770 (GRCm39) T1831A probably damaging Het
Aifm2 T C 10: 61,561,696 (GRCm39) V14A probably damaging Het
Angptl3 A T 4: 98,920,321 (GRCm39) probably null Het
Arfgap1 A T 2: 180,615,912 (GRCm39) D197V possibly damaging Het
Atp1a3 T C 7: 24,678,294 (GRCm39) probably benign Het
Brwd1 T C 16: 95,817,350 (GRCm39) I1387M probably damaging Het
Cavin4 A G 4: 48,672,499 (GRCm39) T315A probably benign Het
Cep128 T C 12: 90,966,410 (GRCm39) T1066A probably benign Het
Cln3 T C 7: 126,171,558 (GRCm39) T376A probably benign Het
Cntn4 A T 6: 106,656,397 (GRCm39) silent Het
Colec12 T A 18: 9,848,963 (GRCm39) D380E probably damaging Het
Csmd3 T C 15: 47,559,151 (GRCm39) I2371V possibly damaging Het
Cspg4b A G 13: 113,453,701 (GRCm39) S55G possibly damaging Het
Cxcl3 T C 5: 90,935,299 (GRCm39) S99P unknown Het
Ddx60 A G 8: 62,453,612 (GRCm39) R1244G probably benign Het
Dhx38 T C 8: 110,280,048 (GRCm39) D914G probably damaging Het
Dlc1 T G 8: 37,404,655 (GRCm39) probably benign Het
Eif4a3l1 A T 6: 136,306,393 (GRCm39) I264F probably benign Het
Fam161b A G 12: 84,403,124 (GRCm39) S169P probably damaging Het
Fastkd1 A G 2: 69,537,725 (GRCm39) S286P possibly damaging Het
Fmn2 A T 1: 174,409,603 (GRCm39) E612V unknown Het
Foxb1 T A 9: 69,667,528 (GRCm39) M1L probably damaging Het
Gm14412 A T 2: 177,007,402 (GRCm39) C164* probably null Het
Gm43302 T A 5: 105,423,678 (GRCm39) M432L probably benign Het
Gm4353 C A 7: 115,682,913 (GRCm39) A223S probably damaging Het
Gpatch8 T C 11: 102,391,693 (GRCm39) K143R unknown Het
Gpr15 A G 16: 58,538,013 (GRCm39) S359P probably damaging Het
Gucy2e A G 11: 69,119,207 (GRCm39) L649P probably damaging Het
H2-M10.5 C A 17: 37,085,473 (GRCm39) H211N probably damaging Het
Hs6st1 T C 1: 36,142,970 (GRCm39) Y302H probably damaging Het
Khdrbs2 A T 1: 32,506,851 (GRCm39) D165V probably damaging Het
Klra13-ps T G 6: 130,281,246 (GRCm39) noncoding transcript Het
Lrrc37 T A 11: 103,507,880 (GRCm39) probably benign Het
Lrrc37a T A 11: 103,391,001 (GRCm39) T1475S probably benign Het
Ly75 A G 2: 60,184,844 (GRCm39) S437P probably damaging Het
Maz C T 7: 126,624,494 (GRCm39) C342Y probably damaging Het
Mcf2l C A 8: 13,063,812 (GRCm39) S1008* probably null Het
Mcmbp T C 7: 128,314,478 (GRCm39) D246G probably benign Het
Mipol1 G A 12: 57,372,346 (GRCm39) R135H possibly damaging Het
Mycbp2 T A 14: 103,357,955 (GRCm39) Y4613F possibly damaging Het
Nup188 G A 2: 30,226,336 (GRCm39) A1118T probably damaging Het
Or10g6 A T 9: 39,933,964 (GRCm39) I92F probably damaging Het
Or2k2 T A 4: 58,785,489 (GRCm39) I78F probably benign Het
Or4a76 G A 2: 89,460,688 (GRCm39) L185F probably damaging Het
Or4c121 A T 2: 89,024,170 (GRCm39) D69E possibly damaging Het
Or4z4 A G 19: 12,076,290 (GRCm39) S238P probably damaging Het
Or51f1e A T 7: 102,747,103 (GRCm39) S52C probably benign Het
Or51h7 T C 7: 102,591,128 (GRCm39) K219E probably benign Het
P3h1 T A 4: 119,101,243 (GRCm39) I460N possibly damaging Het
Pcnt T C 10: 76,245,334 (GRCm39) D1101G probably benign Het
Phlpp2 C A 8: 110,655,205 (GRCm39) Q667K possibly damaging Het
Plec A G 15: 76,074,666 (GRCm39) F434L possibly damaging Het
Ppp6r2 T A 15: 89,164,602 (GRCm39) I602N probably damaging Het
Rdh8 A C 9: 20,736,475 (GRCm39) I181L probably benign Het
Rnf181 A G 6: 72,338,505 (GRCm39) M1T probably null Het
Rpl29-ps2 A G 13: 4,664,221 (GRCm39) noncoding transcript Het
Sart3 A G 5: 113,883,217 (GRCm39) probably null Het
Sec14l2 A C 11: 4,059,189 (GRCm39) L160R probably damaging Het
Senp1 C T 15: 97,946,236 (GRCm39) R503H probably damaging Het
Shoc1 A G 4: 59,047,399 (GRCm39) S1407P probably benign Het
Slc22a2 T C 17: 12,827,296 (GRCm39) V316A probably benign Het
Slc34a1 A T 13: 55,556,898 (GRCm39) I365F possibly damaging Het
Srebf2 C T 15: 82,076,456 (GRCm39) T702I probably benign Het
Sun3 A G 11: 8,981,433 (GRCm39) probably null Het
Syt6 A G 3: 103,528,217 (GRCm39) Y312C probably damaging Het
Tas2r121 T A 6: 132,677,756 (GRCm39) Y72F possibly damaging Het
Tfrc A G 16: 32,442,194 (GRCm39) Y473C probably damaging Het
Trp63 C T 16: 25,684,935 (GRCm39) A274V possibly damaging Het
Trpm5 T C 7: 142,626,966 (GRCm39) D1085G probably benign Het
Ttn A G 2: 76,745,008 (GRCm39) V5347A probably benign Het
Uqcc4 G A 17: 25,403,963 (GRCm39) S101N probably damaging Het
Vma21-ps T A 4: 52,496,946 (GRCm39) Q100L possibly damaging Het
Vmn2r22 T C 6: 123,614,873 (GRCm39) N239S probably benign Het
Wfdc8 T C 2: 164,439,339 (GRCm39) probably benign Het
Xkr4 T A 1: 3,741,258 (GRCm39) Y105F probably damaging Het
Xpo7 C T 14: 70,920,286 (GRCm39) V627I possibly damaging Het
Zfp606 T C 7: 12,226,479 (GRCm39) V200A probably benign Het
Zfp936 A T 7: 42,839,858 (GRCm39) S441C possibly damaging Het
Other mutations in Spag5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Spag5 APN 11 78,195,443 (GRCm39) missense possibly damaging 0.62
IGL01820:Spag5 APN 11 78,195,085 (GRCm39) missense probably benign 0.06
IGL02066:Spag5 APN 11 78,195,358 (GRCm39) missense probably benign
IGL02140:Spag5 APN 11 78,206,459 (GRCm39) missense possibly damaging 0.62
IGL02251:Spag5 APN 11 78,210,860 (GRCm39) missense probably damaging 1.00
IGL02452:Spag5 APN 11 78,195,449 (GRCm39) missense probably benign 0.08
IGL02658:Spag5 APN 11 78,212,157 (GRCm39) nonsense probably null
boyardee UTSW 11 78,204,017 (GRCm39) critical splice donor site probably null
Franco UTSW 11 78,205,008 (GRCm39) nonsense probably null
spaghetto UTSW 11 78,204,205 (GRCm39) nonsense probably null
IGL02991:Spag5 UTSW 11 78,205,077 (GRCm39) missense probably damaging 0.99
R0477:Spag5 UTSW 11 78,205,024 (GRCm39) missense probably damaging 1.00
R0512:Spag5 UTSW 11 78,210,412 (GRCm39) unclassified probably benign
R0535:Spag5 UTSW 11 78,195,554 (GRCm39) missense probably benign 0.00
R0557:Spag5 UTSW 11 78,205,037 (GRCm39) missense probably damaging 0.99
R0584:Spag5 UTSW 11 78,194,921 (GRCm39) missense possibly damaging 0.49
R0666:Spag5 UTSW 11 78,204,222 (GRCm39) missense probably damaging 1.00
R0723:Spag5 UTSW 11 78,210,410 (GRCm39) unclassified probably benign
R1413:Spag5 UTSW 11 78,196,143 (GRCm39) nonsense probably null
R1680:Spag5 UTSW 11 78,211,442 (GRCm39) missense probably damaging 1.00
R1687:Spag5 UTSW 11 78,195,755 (GRCm39) missense probably benign 0.32
R1696:Spag5 UTSW 11 78,212,152 (GRCm39) missense probably damaging 1.00
R1831:Spag5 UTSW 11 78,205,082 (GRCm39) missense probably benign 0.08
R1866:Spag5 UTSW 11 78,195,281 (GRCm39) missense possibly damaging 0.62
R1918:Spag5 UTSW 11 78,195,002 (GRCm39) missense probably benign 0.01
R4004:Spag5 UTSW 11 78,212,355 (GRCm39) missense probably benign 0.22
R4005:Spag5 UTSW 11 78,212,355 (GRCm39) missense probably benign 0.22
R4222:Spag5 UTSW 11 78,195,337 (GRCm39) missense probably damaging 1.00
R4750:Spag5 UTSW 11 78,210,878 (GRCm39) missense probably benign 0.00
R4771:Spag5 UTSW 11 78,195,592 (GRCm39) missense probably damaging 1.00
R4928:Spag5 UTSW 11 78,205,199 (GRCm39) missense probably damaging 0.97
R5360:Spag5 UTSW 11 78,205,588 (GRCm39) missense probably damaging 0.99
R5366:Spag5 UTSW 11 78,211,152 (GRCm39) splice site probably null
R5618:Spag5 UTSW 11 78,194,906 (GRCm39) missense probably benign 0.00
R5762:Spag5 UTSW 11 78,194,972 (GRCm39) missense probably benign 0.25
R5859:Spag5 UTSW 11 78,204,360 (GRCm39) missense probably benign 0.38
R6564:Spag5 UTSW 11 78,206,401 (GRCm39) missense probably damaging 1.00
R6571:Spag5 UTSW 11 78,212,095 (GRCm39) missense probably damaging 1.00
R6573:Spag5 UTSW 11 78,205,008 (GRCm39) nonsense probably null
R7074:Spag5 UTSW 11 78,195,868 (GRCm39) critical splice donor site probably null
R7091:Spag5 UTSW 11 78,204,017 (GRCm39) critical splice donor site probably null
R7332:Spag5 UTSW 11 78,204,205 (GRCm39) nonsense probably null
R8073:Spag5 UTSW 11 78,192,803 (GRCm39) missense probably benign 0.22
R8709:Spag5 UTSW 11 78,192,738 (GRCm39) missense probably benign
R8723:Spag5 UTSW 11 78,212,215 (GRCm39) missense probably damaging 1.00
R8976:Spag5 UTSW 11 78,195,413 (GRCm39) missense probably benign 0.01
R9053:Spag5 UTSW 11 78,212,575 (GRCm39) missense probably benign 0.14
R9142:Spag5 UTSW 11 78,192,823 (GRCm39) missense possibly damaging 0.56
Z1176:Spag5 UTSW 11 78,205,808 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACACTGAAGATGCACCTGTG -3'
(R):5'- AGGTTTTGTAGCATGACCGATG -3'

Sequencing Primer
(F):5'- AAGATGCACCTGTGGACTTAGTTCC -3'
(R):5'- GTAGCATGACCGATGTATTCACAC -3'
Posted On 2016-11-09