Mutagenetix > Incidental Mutation

Incidental Mutation 'R5668:Lrrc37a'

442461

Institutional Source

Beutler Lab

Gene Symbol

Lrrc37a

Ensembl Gene

ENSMUSG00000078632

Gene Name

leucine rich repeat containing 37A

Synonyms

LOC237954

MMRRC Submission

043311-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R5668 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103451955-103504597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 103500175 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1475 (T1475S)

Ref Sequence

ENSEMBL: ENSMUSP00000121903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000153273]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000153273
AA Change: T1475S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: T1475S

Domain	Start	End	E-Value	Type
Pfam:LRRC37	199	269	2.6e-15	PFAM
low complexity region	313	329	N/A	INTRINSIC
Pfam:LRRC37	363	432	4e-18	PFAM
low complexity region	457	467	N/A	INTRINSIC
low complexity region	480	492	N/A	INTRINSIC
Pfam:LRRC37	550	619	2.1e-21	PFAM
Pfam:LRRC37	637	704	2.9e-12	PFAM
Pfam:LRRC37	780	851	2.5e-12	PFAM
Pfam:LRRC37	1078	1148	2.7e-18	PFAM
Pfam:LRRC37	1149	1190	2.1e-7	PFAM
Pfam:LRRC37	1187	1258	2.5e-25	PFAM
Pfam:LRRC37	1255	1300	2.6e-7	PFAM
Pfam:LRRC37	1299	1370	2.4e-27	PFAM
Pfam:LRRC37	1369	1420	2.9e-8	PFAM
Pfam:LRRC37	1419	1488	1.3e-24	PFAM
Pfam:LRRC37	1509	1578	9.2e-21	PFAM
Pfam:LRRC37	1575	1620	1.7e-6	PFAM
Pfam:LRRC37	1619	1686	1.7e-20	PFAM
Pfam:LRRC37	1690	1736	7e-10	PFAM
Pfam:LRRC37	1733	1799	7.5e-17	PFAM
Pfam:LRRC37	1789	1854	5.1e-12	PFAM
Pfam:LRRC37	1850	1921	4.2e-21	PFAM
Pfam:LRRC37	1915	1969	1.1e-9	PFAM
low complexity region	2143	2167	N/A	INTRINSIC
low complexity region	2185	2209	N/A	INTRINSIC
low complexity region	2228	2249	N/A	INTRINSIC
low complexity region	2262	2274	N/A	INTRINSIC
low complexity region	2284	2297	N/A	INTRINSIC
LRR	2419	2438	3.09e1	SMART
LRR	2439	2462	9.96e-1	SMART
LRR	2463	2486	8.24e0	SMART
LRR	2490	2514	3.18e1	SMART
low complexity region	2535	2547	N/A	INTRINSIC
coiled coil region	2712	2735	N/A	INTRINSIC
low complexity region	2861	2871	N/A	INTRINSIC
low complexity region	2937	2950	N/A	INTRINSIC
Pfam:LRRC37AB_C	3063	3209	1.1e-77	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

99% (84/85)

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn4	A	G	7: 28,904,550	W429R	probably damaging	Het
Afg1l	C	T	10: 42,360,240	C272Y	probably damaging	Het
Agrn	T	C	4: 156,167,313	T1831A	probably damaging	Het
AI481877	A	G	4: 59,047,399	S1407P	probably benign	Het
Aifm2	T	C	10: 61,725,917	V14A	probably damaging	Het
Angptl3	A	T	4: 99,032,084		probably null	Het
Arfgap1	A	T	2: 180,974,119	D197V	possibly damaging	Het
Atp1a3	T	C	7: 24,978,869		probably benign	Het
BC003965	G	A	17: 25,184,989	S101N	probably damaging	Het
BC067074	A	G	13: 113,317,167	S55G	possibly damaging	Het
Brwd1	T	C	16: 96,016,150	I1387M	probably damaging	Het
Cavin4	A	G	4: 48,672,499	T315A	probably benign	Het
Cep128	T	C	12: 90,999,636	T1066A	probably benign	Het
Cln3	T	C	7: 126,572,386	T376A	probably benign	Het
Cntn4	A	T	6: 106,679,436		silent	Het
Colec12	T	A	18: 9,848,963	D380E	probably damaging	Het
Csmd3	T	C	15: 47,695,755	I2371V	possibly damaging	Het
Cxcl3	T	C	5: 90,787,440	S99P	unknown	Het
Ddx60	A	G	8: 62,000,578	R1244G	probably benign	Het
Dhx38	T	C	8: 109,553,416	D914G	probably damaging	Het
Dlc1	T	G	8: 36,937,501		probably benign	Het
Fam161b	A	G	12: 84,356,350	S169P	probably damaging	Het
Fastkd1	A	G	2: 69,707,381	S286P	possibly damaging	Het
Fmn2	A	T	1: 174,582,037	E612V	unknown	Het
Foxb1	T	A	9: 69,760,246	M1L	probably damaging	Het
Gm14412	A	T	2: 177,315,609	C164*	probably null	Het
Gm43302	T	A	5: 105,275,812	M432L	probably benign	Het
Gm4353	C	A	7: 116,083,678	A223S	probably damaging	Het
Gm884	T	A	11: 103,617,054		probably benign	Het
Gm8994	A	T	6: 136,329,395	I264F	probably benign	Het
Gpatch8	T	C	11: 102,500,867	K143R	unknown	Het
Gpr15	A	G	16: 58,717,650	S359P	probably damaging	Het
Gucy2e	A	G	11: 69,228,381	L649P	probably damaging	Het
H2-M10.5	C	A	17: 36,774,581	H211N	probably damaging	Het
Hs6st1	T	C	1: 36,103,889	Y302H	probably damaging	Het
Khdrbs2	A	T	1: 32,467,770	D165V	probably damaging	Het
Klra13-ps	T	G	6: 130,304,283		noncoding transcript	Het
Ly75	A	G	2: 60,354,500	S437P	probably damaging	Het
Maz	C	T	7: 127,025,322	C342Y	probably damaging	Het
Mcf2l	C	A	8: 13,013,812	S1008*	probably null	Het
Mcmbp	T	C	7: 128,712,754	D246G	probably benign	Het
Mipol1	G	A	12: 57,325,560	R135H	possibly damaging	Het
Mycbp2	T	A	14: 103,120,519	Y4613F	possibly damaging	Het
Nup188	G	A	2: 30,336,324	A1118T	probably damaging	Het
Olfr1226	A	T	2: 89,193,826	D69E	possibly damaging	Het
Olfr1249	G	A	2: 89,630,344	L185F	probably damaging	Het
Olfr1427	A	G	19: 12,098,926	S238P	probably damaging	Het
Olfr267	T	A	4: 58,785,489	I78F	probably benign	Het
Olfr573-ps1	T	C	7: 102,941,921	K219E	probably benign	Het
Olfr585	A	T	7: 103,097,896	S52C	probably benign	Het
Olfr981	A	T	9: 40,022,668	I92F	probably damaging	Het
P3h1	T	A	4: 119,244,046	I460N	possibly damaging	Het
Pcnt	T	C	10: 76,409,500	D1101G	probably benign	Het
Phlpp2	C	A	8: 109,928,573	Q667K	possibly damaging	Het
Plec	A	G	15: 76,190,466	F434L	possibly damaging	Het
Ppp6r2	T	A	15: 89,280,399	I602N	probably damaging	Het
Rdh8	A	C	9: 20,825,179	I181L	probably benign	Het
Rnf181	A	G	6: 72,361,522	M1T	probably null	Het
Rpl29-ps2	A	G	13: 4,614,222		noncoding transcript	Het
Sart3	A	G	5: 113,745,156		probably null	Het
Sec14l2	A	C	11: 4,109,189	L160R	probably damaging	Het
Senp1	C	T	15: 98,048,355	R503H	probably damaging	Het
Slc22a2	T	C	17: 12,608,409	V316A	probably benign	Het
Slc34a1	A	T	13: 55,409,085	I365F	possibly damaging	Het
Spag5	T	C	11: 78,304,716	V283A	possibly damaging	Het
Srebf2	C	T	15: 82,192,255	T702I	probably benign	Het
Sun3	A	G	11: 9,031,433		probably null	Het
Syt6	A	G	3: 103,620,901	Y312C	probably damaging	Het
Tas2r121	T	A	6: 132,700,793	Y72F	possibly damaging	Het
Tfrc	A	G	16: 32,623,376	Y473C	probably damaging	Het
Trp63	C	T	16: 25,866,185	A274V	possibly damaging	Het
Trpm5	T	C	7: 143,073,229	D1085G	probably benign	Het
Ttn	A	G	2: 76,914,664	V5347A	probably benign	Het
Vma21-ps	T	A	4: 52,496,946	Q100L	possibly damaging	Het
Vmn2r22	T	C	6: 123,637,914	N239S	probably benign	Het
Wfdc8	T	C	2: 164,597,419		probably benign	Het
Xkr4	T	A	1: 3,671,035	Y105F	probably damaging	Het
Xpo7	C	T	14: 70,682,846	V627I	possibly damaging	Het
Zfp606	T	C	7: 12,492,552	V200A	probably benign	Het
Zfp936	A	T	7: 43,190,434	S441C	possibly damaging	Het

Other mutations in Lrrc37a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Lrrc37a	APN	11	103500351	missense	probably benign	0.09
IGL01339:Lrrc37a	APN	11	103497937	missense	unknown
IGL01352:Lrrc37a	APN	11	103499355	missense	probably benign	0.39
IGL01382:Lrrc37a	APN	11	103498755	missense	probably damaging	0.99
IGL01395:Lrrc37a	APN	11	103503861	missense	probably benign	0.24
IGL01645:Lrrc37a	APN	11	103504264	missense	probably benign	0.01
IGL01925:Lrrc37a	APN	11	103498419	missense	probably benign	0.01
IGL02006:Lrrc37a	APN	11	103456491	missense	probably damaging	1.00
IGL02127:Lrrc37a	APN	11	103504539	missense	probably benign	0.01
IGL02184:Lrrc37a	APN	11	103497609	missense	unknown
IGL02218:Lrrc37a	APN	11	103500381	missense	probably benign	0.03
IGL02436:Lrrc37a	APN	11	103498177	missense	unknown
IGL02487:Lrrc37a	APN	11	103496037	missense	unknown
IGL02597:Lrrc37a	APN	11	103504287	missense	probably benign	0.01
IGL02634:Lrrc37a	APN	11	103499112	missense	probably benign	0.09
IGL02818:Lrrc37a	APN	11	103501306	missense	possibly damaging	0.47
IGL02829:Lrrc37a	APN	11	103491174	missense	unknown
IGL02987:Lrrc37a	APN	11	103500413	missense	probably benign	0.03
IGL03081:Lrrc37a	APN	11	103456595	missense	unknown
IGL03210:Lrrc37a	APN	11	103499505	missense	probably benign	0.29
IGL03239:Lrrc37a	APN	11	103499407	missense	probably benign	0.03
IGL03285:Lrrc37a	APN	11	103497673	missense	unknown
IGL03296:Lrrc37a	APN	11	103497673	missense	unknown
IGL03299:Lrrc37a	APN	11	103497673	missense	unknown
IGL03370:Lrrc37a	APN	11	103497673	missense	unknown
IGL03390:Lrrc37a	APN	11	103496031	missense	unknown
Lark	UTSW	11	103464354	critical splice donor site	probably null
Longspur	UTSW	11	103502314	missense	probably benign	0.42
F5770:Lrrc37a	UTSW	11	103455512	missense	possibly damaging	0.95
P0035:Lrrc37a	UTSW	11	103503132	missense	possibly damaging	0.84
PIT4458001:Lrrc37a	UTSW	11	103504512	missense	probably benign	0.04
R0112:Lrrc37a	UTSW	11	103500913	missense	probably benign	0.19
R0194:Lrrc37a	UTSW	11	103499790	missense	possibly damaging	0.82
R0360:Lrrc37a	UTSW	11	103500640	missense	possibly damaging	0.89
R0364:Lrrc37a	UTSW	11	103500640	missense	possibly damaging	0.89
R0395:Lrrc37a	UTSW	11	103464395	missense	unknown
R0418:Lrrc37a	UTSW	11	103503438	missense	probably benign	0.03
R0505:Lrrc37a	UTSW	11	103503025	missense	probably benign	0.10
R0583:Lrrc37a	UTSW	11	103498437	missense	probably benign	0.01
R1078:Lrrc37a	UTSW	11	103497631	missense	unknown
R1581:Lrrc37a	UTSW	11	103457017	nonsense	probably null
R1888:Lrrc37a	UTSW	11	103498761	missense	probably benign	0.18
R1888:Lrrc37a	UTSW	11	103498761	missense	probably benign	0.18
R1907:Lrrc37a	UTSW	11	103457156	missense	unknown
R1982:Lrrc37a	UTSW	11	103498966	missense	probably benign	0.20
R1991:Lrrc37a	UTSW	11	103500261	missense	probably benign	0.29
R2017:Lrrc37a	UTSW	11	103501125	missense	probably benign	0.03
R2103:Lrrc37a	UTSW	11	103500261	missense	probably benign	0.29
R2110:Lrrc37a	UTSW	11	103497822	missense	unknown
R2190:Lrrc37a	UTSW	11	103500043	missense	possibly damaging	0.82
R2252:Lrrc37a	UTSW	11	103501467	missense	probably benign	0.01
R2253:Lrrc37a	UTSW	11	103501467	missense	probably benign	0.01
R2894:Lrrc37a	UTSW	11	103497864	missense	unknown
R2899:Lrrc37a	UTSW	11	103497864	missense	unknown
R3439:Lrrc37a	UTSW	11	103497864	missense	unknown
R3899:Lrrc37a	UTSW	11	103497546	missense	unknown
R3916:Lrrc37a	UTSW	11	103455518	missense	possibly damaging	0.83
R3921:Lrrc37a	UTSW	11	103501470	missense	probably benign	0.10
R3977:Lrrc37a	UTSW	11	103457604	missense	unknown
R4043:Lrrc37a	UTSW	11	103498653	missense	possibly damaging	0.95
R4077:Lrrc37a	UTSW	11	103497982	missense	unknown
R4237:Lrrc37a	UTSW	11	103502289	missense	probably damaging	0.97
R4461:Lrrc37a	UTSW	11	103464354	critical splice donor site	probably null
R4498:Lrrc37a	UTSW	11	103501798	missense	probably benign	0.20
R4593:Lrrc37a	UTSW	11	103498969	missense	possibly damaging	0.64
R4670:Lrrc37a	UTSW	11	103504537	missense	probably benign	0.10
R4698:Lrrc37a	UTSW	11	103504104	missense	possibly damaging	0.83
R4750:Lrrc37a	UTSW	11	103455480	missense	probably benign	0.24
R4805:Lrrc37a	UTSW	11	103504309	missense	probably benign	0.01
R4940:Lrrc37a	UTSW	11	103497612	missense	unknown
R4983:Lrrc37a	UTSW	11	103497618	missense	unknown
R4989:Lrrc37a	UTSW	11	103456739	missense	unknown
R5046:Lrrc37a	UTSW	11	103498240	missense	unknown
R5217:Lrrc37a	UTSW	11	103456954	missense	unknown
R5300:Lrrc37a	UTSW	11	103456958	missense	unknown
R5509:Lrrc37a	UTSW	11	103500535	missense	probably benign	0.23
R5550:Lrrc37a	UTSW	11	103498177	missense	unknown
R5655:Lrrc37a	UTSW	11	103498555	missense	probably benign	0.28
R5750:Lrrc37a	UTSW	11	103458097	missense	unknown
R5815:Lrrc37a	UTSW	11	103503786	missense	probably benign	0.01
R5976:Lrrc37a	UTSW	11	103499071	missense	possibly damaging	0.73
R5990:Lrrc37a	UTSW	11	103500958	missense	probably benign	0.19
R6004:Lrrc37a	UTSW	11	103502536	missense	possibly damaging	0.56
R6019:Lrrc37a	UTSW	11	103456596	missense	unknown
R6056:Lrrc37a	UTSW	11	103497658	missense	unknown
R6125:Lrrc37a	UTSW	11	103501560	missense	probably benign	0.19
R6190:Lrrc37a	UTSW	11	103501216	missense	possibly damaging	0.67
R6295:Lrrc37a	UTSW	11	103497633	missense	unknown
R6320:Lrrc37a	UTSW	11	103504051	missense	probably benign	0.10
R6354:Lrrc37a	UTSW	11	103464387	missense	unknown
R6375:Lrrc37a	UTSW	11	103501089	missense	probably benign	0.19
R6406:Lrrc37a	UTSW	11	103497535	missense	unknown
R6468:Lrrc37a	UTSW	11	103460840	missense	unknown
R6490:Lrrc37a	UTSW	11	103456660	missense	unknown
R6502:Lrrc37a	UTSW	11	103492179	missense	unknown
R6509:Lrrc37a	UTSW	11	103504414	missense	probably benign	0.04
R6749:Lrrc37a	UTSW	11	103502097	missense	probably benign	0.29
R6768:Lrrc37a	UTSW	11	103500123	missense	probably benign	0.36
R6912:Lrrc37a	UTSW	11	103457543	missense	unknown
R7081:Lrrc37a	UTSW	11	103457955	missense	unknown
R7083:Lrrc37a	UTSW	11	103503340	missense	probably benign	0.03
R7154:Lrrc37a	UTSW	11	103502856	missense	probably benign	0.03
R7195:Lrrc37a	UTSW	11	103457775	missense	unknown
R7265:Lrrc37a	UTSW	11	103498941	missense	probably benign	0.09
R7276:Lrrc37a	UTSW	11	103456746	missense	unknown
R7362:Lrrc37a	UTSW	11	103457509	missense	unknown
R7450:Lrrc37a	UTSW	11	103498326	missense	probably benign	0.01
R7458:Lrrc37a	UTSW	11	103497432	missense	unknown
R7487:Lrrc37a	UTSW	11	103498219	missense	unknown
R7535:Lrrc37a	UTSW	11	103501857	missense	possibly damaging	0.68
R7593:Lrrc37a	UTSW	11	103500952	missense	probably benign	0.03
R7677:Lrrc37a	UTSW	11	103499638	missense	probably benign	0.26
R7686:Lrrc37a	UTSW	11	103498236	missense	unknown
R7694:Lrrc37a	UTSW	11	103504378	missense	probably benign	0.12
R7696:Lrrc37a	UTSW	11	103498437	missense	probably benign	0.01
R7717:Lrrc37a	UTSW	11	103504300	missense	probably benign	0.01
R7736:Lrrc37a	UTSW	11	103497459	missense	unknown
R7841:Lrrc37a	UTSW	11	103501105	missense	probably benign	0.03
R7885:Lrrc37a	UTSW	11	103503042	missense	probably benign	0.01
R7888:Lrrc37a	UTSW	11	103501481	missense	probably benign	0.19
R7993:Lrrc37a	UTSW	11	103457961	missense	unknown
R8051:Lrrc37a	UTSW	11	103503126	missense	possibly damaging	0.48
R8082:Lrrc37a	UTSW	11	103457422	missense	unknown
R8097:Lrrc37a	UTSW	11	103504099	missense	probably benign	0.04
R8108:Lrrc37a	UTSW	11	103503057	missense	probably benign	0.24
R8269:Lrrc37a	UTSW	11	103497898	missense	unknown
R8311:Lrrc37a	UTSW	11	103503421	missense	probably benign	0.05
R8403:Lrrc37a	UTSW	11	103501585	missense	probably benign	0.10
R8408:Lrrc37a	UTSW	11	103460809	missense	unknown
R8529:Lrrc37a	UTSW	11	103457547	missense	unknown
R8711:Lrrc37a	UTSW	11	103497524	nonsense	probably null
R8757:Lrrc37a	UTSW	11	103457940	missense	unknown
R8759:Lrrc37a	UTSW	11	103457940	missense	unknown
R8769:Lrrc37a	UTSW	11	103498710	missense	probably benign	0.10
R8785:Lrrc37a	UTSW	11	103456416	missense	probably damaging	1.00
R8837:Lrrc37a	UTSW	11	103503969	missense	probably benign	0.43
R8850:Lrrc37a	UTSW	11	103502655	missense
R8871:Lrrc37a	UTSW	11	103456549	missense	unknown
R8894:Lrrc37a	UTSW	11	103456623	missense	unknown
R8971:Lrrc37a	UTSW	11	103500664	missense	probably benign	0.19
R8979:Lrrc37a	UTSW	11	103503007	missense	possibly damaging	0.48
R9012:Lrrc37a	UTSW	11	103499152	missense	probably benign	0.05
R9047:Lrrc37a	UTSW	11	103500549	missense	probably damaging	0.97
R9167:Lrrc37a	UTSW	11	103456832	missense	unknown
R9171:Lrrc37a	UTSW	11	103502314	missense	probably benign	0.42
R9194:Lrrc37a	UTSW	11	103500850	missense	probably benign	0.03
R9258:Lrrc37a	UTSW	11	103502196	missense	probably benign	0.20
R9282:Lrrc37a	UTSW	11	103500807	missense	probably benign	0.03
R9294:Lrrc37a	UTSW	11	103504533	missense	probably benign	0.10
R9349:Lrrc37a	UTSW	11	103497628	missense	unknown
R9560:Lrrc37a	UTSW	11	103456594	missense	unknown
R9595:Lrrc37a	UTSW	11	103501726	missense	probably benign	0.01
R9628:Lrrc37a	UTSW	11	103503504	missense	probably benign	0.03
V7580:Lrrc37a	UTSW	11	103455512	missense	possibly damaging	0.95
X0018:Lrrc37a	UTSW	11	103499544	missense	possibly damaging	0.78
Z1176:Lrrc37a	UTSW	11	103456486	missense	probably damaging	1.00
Z1176:Lrrc37a	UTSW	11	103499034	missense	possibly damaging	0.68
Z1176:Lrrc37a	UTSW	11	103501094	missense	probably benign	0.09
Z1177:Lrrc37a	UTSW	11	103499967	missense	possibly damaging	0.46
Z1177:Lrrc37a	UTSW	11	103500520	missense	probably benign	0.43
Z1177:Lrrc37a	UTSW	11	103500598	missense	probably benign	0.20
Z1177:Lrrc37a	UTSW	11	103503027	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- CTTGGTGTTGAAACTGTCACC -3'
(R):5'- AGCCTGTGGATCTAGGACTTAC -3'

Sequencing Primer
(F):5'- ACTGTCACCTCTTGATATAGTGGAG -3'
(R):5'- GTGGATCTAGGACTTACCATAACTCC -3'

Posted On

2016-11-09