Incidental Mutation 'R5668:BC067074'
ID442468
Institutional Source Beutler Lab
Gene Symbol BC067074
Ensembl Gene ENSMUSG00000021763
Gene NamecDNA sequence BC067074
Synonyms
MMRRC Submission 043311-MU
Accession Numbers

Ncbi RefSeq: none; VEGA: OTTMUST00000084794; MGI:3040697

Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R5668 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location113293159-113379711 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113317167 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 55 (S55G)
Ref Sequence ENSEMBL: ENSMUSP00000119993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000136755]
Predicted Effect possibly damaging
Transcript: ENSMUST00000136755
AA Change: S55G

PolyPhen 2 Score 0.550 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119993
Gene: ENSMUSG00000021763
AA Change: S55G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LamG 44 177 1.28e-20 SMART
LamG 229 371 4.66e-14 SMART
low complexity region 407 420 N/A INTRINSIC
Pfam:Cadherin_3 492 644 2.1e-35 PFAM
Pfam:Cadherin_3 647 759 1e-7 PFAM
Pfam:Cadherin_3 741 873 1.2e-8 PFAM
Pfam:Cadherin_3 861 989 4.1e-14 PFAM
Pfam:Cadherin_3 958 1114 1.2e-20 PFAM
Pfam:Cadherin_3 1117 1223 1.6e-10 PFAM
Pfam:Cadherin_3 1212 1341 5.6e-12 PFAM
Pfam:Cadherin_3 1347 1438 3.8e-8 PFAM
Pfam:Cadherin_3 1419 1562 2.3e-45 PFAM
Pfam:Cadherin_3 1576 1679 2.1e-9 PFAM
low complexity region 1732 1740 N/A INTRINSIC
Pfam:Cadherin_3 1773 1926 3e-35 PFAM
transmembrane domain 2267 2289 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (84/85)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,904,550 W429R probably damaging Het
Afg1l C T 10: 42,360,240 C272Y probably damaging Het
Agrn T C 4: 156,167,313 T1831A probably damaging Het
AI481877 A G 4: 59,047,399 S1407P probably benign Het
Aifm2 T C 10: 61,725,917 V14A probably damaging Het
Angptl3 A T 4: 99,032,084 probably null Het
Arfgap1 A T 2: 180,974,119 D197V possibly damaging Het
Atp1a3 T C 7: 24,978,869 probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Brwd1 T C 16: 96,016,150 I1387M probably damaging Het
Cavin4 A G 4: 48,672,499 T315A probably benign Het
Cep128 T C 12: 90,999,636 T1066A probably benign Het
Cln3 T C 7: 126,572,386 T376A probably benign Het
Cntn4 A T 6: 106,679,436 silent Het
Colec12 T A 18: 9,848,963 D380E probably damaging Het
Csmd3 T C 15: 47,695,755 I2371V possibly damaging Het
Cxcl3 T C 5: 90,787,440 S99P unknown Het
Ddx60 A G 8: 62,000,578 R1244G probably benign Het
Dhx38 T C 8: 109,553,416 D914G probably damaging Het
Dlc1 T G 8: 36,937,501 probably benign Het
Fam161b A G 12: 84,356,350 S169P probably damaging Het
Fastkd1 A G 2: 69,707,381 S286P possibly damaging Het
Fmn2 A T 1: 174,582,037 E612V unknown Het
Foxb1 T A 9: 69,760,246 M1L probably damaging Het
Gm14412 A T 2: 177,315,609 C164* probably null Het
Gm43302 T A 5: 105,275,812 M432L probably benign Het
Gm4353 C A 7: 116,083,678 A223S probably damaging Het
Gm884 T A 11: 103,617,054 probably benign Het
Gm8994 A T 6: 136,329,395 I264F probably benign Het
Gpatch8 T C 11: 102,500,867 K143R unknown Het
Gpr15 A G 16: 58,717,650 S359P probably damaging Het
Gucy2e A G 11: 69,228,381 L649P probably damaging Het
H2-M10.5 C A 17: 36,774,581 H211N probably damaging Het
Hs6st1 T C 1: 36,103,889 Y302H probably damaging Het
Khdrbs2 A T 1: 32,467,770 D165V probably damaging Het
Klra13-ps T G 6: 130,304,283 noncoding transcript Het
Lrrc37a T A 11: 103,500,175 T1475S probably benign Het
Ly75 A G 2: 60,354,500 S437P probably damaging Het
Maz C T 7: 127,025,322 C342Y probably damaging Het
Mcf2l C A 8: 13,013,812 S1008* probably null Het
Mcmbp T C 7: 128,712,754 D246G probably benign Het
Mipol1 G A 12: 57,325,560 R135H possibly damaging Het
Mycbp2 T A 14: 103,120,519 Y4613F possibly damaging Het
Nup188 G A 2: 30,336,324 A1118T probably damaging Het
Olfr1226 A T 2: 89,193,826 D69E possibly damaging Het
Olfr1249 G A 2: 89,630,344 L185F probably damaging Het
Olfr1427 A G 19: 12,098,926 S238P probably damaging Het
Olfr267 T A 4: 58,785,489 I78F probably benign Het
Olfr573-ps1 T C 7: 102,941,921 K219E probably benign Het
Olfr585 A T 7: 103,097,896 S52C probably benign Het
Olfr981 A T 9: 40,022,668 I92F probably damaging Het
P3h1 T A 4: 119,244,046 I460N possibly damaging Het
Pcnt T C 10: 76,409,500 D1101G probably benign Het
Phlpp2 C A 8: 109,928,573 Q667K possibly damaging Het
Plec A G 15: 76,190,466 F434L possibly damaging Het
Ppp6r2 T A 15: 89,280,399 I602N probably damaging Het
Rdh8 A C 9: 20,825,179 I181L probably benign Het
Rnf181 A G 6: 72,361,522 M1T probably null Het
Rpl29-ps2 A G 13: 4,614,222 noncoding transcript Het
Sart3 A G 5: 113,745,156 probably null Het
Sec14l2 A C 11: 4,109,189 L160R probably damaging Het
Senp1 C T 15: 98,048,355 R503H probably damaging Het
Slc22a2 T C 17: 12,608,409 V316A probably benign Het
Slc34a1 A T 13: 55,409,085 I365F possibly damaging Het
Spag5 T C 11: 78,304,716 V283A possibly damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Sun3 A G 11: 9,031,433 probably null Het
Syt6 A G 3: 103,620,901 Y312C probably damaging Het
Tas2r121 T A 6: 132,700,793 Y72F possibly damaging Het
Tfrc A G 16: 32,623,376 Y473C probably damaging Het
Trp63 C T 16: 25,866,185 A274V possibly damaging Het
Trpm5 T C 7: 143,073,229 D1085G probably benign Het
Ttn A G 2: 76,914,664 V5347A probably benign Het
Vma21-ps T A 4: 52,496,946 Q100L possibly damaging Het
Vmn2r22 T C 6: 123,637,914 N239S probably benign Het
Wfdc8 T C 2: 164,597,419 probably benign Het
Xkr4 T A 1: 3,671,035 Y105F probably damaging Het
Xpo7 C T 14: 70,682,846 V627I possibly damaging Het
Zfp606 T C 7: 12,492,552 V200A probably benign Het
Zfp936 A T 7: 43,190,434 S441C possibly damaging Het
Other mutations in BC067074
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:BC067074 APN 13 113367557 missense possibly damaging 0.91
IGL03023:BC067074 APN 13 113351741 missense probably benign 0.03
cumpleanos UTSW 13 113368336 missense possibly damaging 0.87
Sorpresa UTSW 13 113318191 missense probably damaging 1.00
P0018:BC067074 UTSW 13 113367506 missense possibly damaging 0.60
R0003:BC067074 UTSW 13 113368776 missense probably benign 0.00
R0016:BC067074 UTSW 13 113366105 missense probably damaging 1.00
R0016:BC067074 UTSW 13 113366105 missense probably damaging 1.00
R0053:BC067074 UTSW 13 113368489 missense probably benign 0.00
R0053:BC067074 UTSW 13 113368489 missense probably benign 0.00
R0158:BC067074 UTSW 13 113369153 nonsense probably null
R0281:BC067074 UTSW 13 113369143 missense probably damaging 1.00
R1212:BC067074 UTSW 13 113369417 intron probably benign
R1300:BC067074 UTSW 13 113366160 missense probably damaging 1.00
R1434:BC067074 UTSW 13 113368492 missense possibly damaging 0.46
R1509:BC067074 UTSW 13 113368256 missense probably damaging 0.99
R1738:BC067074 UTSW 13 113367500 missense possibly damaging 0.69
R1758:BC067074 UTSW 13 113368732 missense possibly damaging 0.78
R1828:BC067074 UTSW 13 113368808 missense probably damaging 1.00
R2061:BC067074 UTSW 13 113318094 missense probably damaging 0.99
R2570:BC067074 UTSW 13 113318587 missense probably benign 0.34
R2884:BC067074 UTSW 13 113320682 missense probably damaging 1.00
R2884:BC067074 UTSW 13 113369191 missense probably benign 0.00
R3004:BC067074 UTSW 13 113366154 missense probably damaging 1.00
R3150:BC067074 UTSW 13 113351760 missense probably damaging 1.00
R3773:BC067074 UTSW 13 113318209 missense probably benign 0.12
R3864:BC067074 UTSW 13 113322951 missense possibly damaging 0.64
R3971:BC067074 UTSW 13 113317126 missense probably damaging 1.00
R4004:BC067074 UTSW 13 113318380 missense probably benign 0.00
R4271:BC067074 UTSW 13 113342370 missense possibly damaging 0.76
R4382:BC067074 UTSW 13 113322754 missense probably benign 0.10
R4484:BC067074 UTSW 13 113319199 missense probably damaging 0.98
R4570:BC067074 UTSW 13 113318191 missense probably damaging 1.00
R4600:BC067074 UTSW 13 113319249 missense possibly damaging 0.95
R4622:BC067074 UTSW 13 113320081 missense probably benign 0.00
R4676:BC067074 UTSW 13 113368807 missense probably damaging 0.98
R4676:BC067074 UTSW 13 113368808 missense probably damaging 1.00
R4677:BC067074 UTSW 13 113379486 missense unknown
R4775:BC067074 UTSW 13 113317695 missense possibly damaging 0.91
R4779:BC067074 UTSW 13 113368336 missense possibly damaging 0.87
R4780:BC067074 UTSW 13 113317858 missense probably damaging 1.00
R4829:BC067074 UTSW 13 113368162 missense probably benign 0.05
R4841:BC067074 UTSW 13 113366190 missense probably benign 0.00
R4879:BC067074 UTSW 13 113319787 missense probably benign 0.03
R4930:BC067074 UTSW 13 113327662 missense probably damaging 1.00
R4934:BC067074 UTSW 13 113368348 missense probably damaging 1.00
R4987:BC067074 UTSW 13 113318101 missense probably benign 0.07
R5065:BC067074 UTSW 13 113320919 missense probably benign 0.01
R5216:BC067074 UTSW 13 113342413 missense probably benign 0.20
R5236:BC067074 UTSW 13 113366220 missense probably benign 0.14
R5247:BC067074 UTSW 13 113319459 missense probably damaging 1.00
R5250:BC067074 UTSW 13 113319771 missense possibly damaging 0.95
R5337:BC067074 UTSW 13 113318765 missense probably damaging 1.00
R5342:BC067074 UTSW 13 113366269 critical splice donor site probably null
R5426:BC067074 UTSW 13 113369053 missense probably benign 0.01
R5472:BC067074 UTSW 13 113319169 missense probably benign 0.12
R5526:BC067074 UTSW 13 113367893 missense probably benign 0.22
R5543:BC067074 UTSW 13 113320873 missense probably damaging 0.96
R5589:BC067074 UTSW 13 113317950 missense possibly damaging 0.95
R5623:BC067074 UTSW 13 113346634 missense possibly damaging 0.95
R5793:BC067074 UTSW 13 113321022 missense possibly damaging 0.75
R5824:BC067074 UTSW 13 113368620 missense probably damaging 1.00
R6038:BC067074 UTSW 13 113318619 missense possibly damaging 0.49
R6038:BC067074 UTSW 13 113318619 missense possibly damaging 0.49
R6053:BC067074 UTSW 13 113320726 missense possibly damaging 0.51
R6125:BC067074 UTSW 13 113317683 missense probably benign 0.00
R6129:BC067074 UTSW 13 113368806 nonsense probably null
R6290:BC067074 UTSW 13 113319958 missense probably damaging 0.97
R6291:BC067074 UTSW 13 113320447 missense possibly damaging 0.85
R6302:BC067074 UTSW 13 113368112 missense probably damaging 1.00
R6317:BC067074 UTSW 13 113368268 missense probably benign 0.09
R6395:BC067074 UTSW 13 113369469 missense probably damaging 1.00
R6673:BC067074 UTSW 13 113367832 nonsense probably null
R6783:BC067074 UTSW 13 113320209 nonsense probably null
R6800:BC067074 UTSW 13 113368152 missense probably benign 0.02
R6857:BC067074 UTSW 13 113319958 missense probably damaging 0.97
R6889:BC067074 UTSW 13 113318378 missense probably damaging 0.99
R6934:BC067074 UTSW 13 113369266 missense probably benign
R7019:BC067074 UTSW 13 113351750 missense probably benign 0.01
R7100:BC067074 UTSW 13 113318967 missense
R7115:BC067074 UTSW 13 113320776 missense
R7152:BC067074 UTSW 13 113318850 missense
R7195:BC067074 UTSW 13 113367929 missense
R7213:BC067074 UTSW 13 113317941 missense
R7250:BC067074 UTSW 13 113318815 missense
R7341:BC067074 UTSW 13 113318172 missense
R7358:BC067074 UTSW 13 113319967 missense
R7359:BC067074 UTSW 13 113342430 missense
R7396:BC067074 UTSW 13 113318990 missense
R7632:BC067074 UTSW 13 113320886 missense
R7689:BC067074 UTSW 13 113379414 missense
R7713:BC067074 UTSW 13 113346541 missense
Predicted Primers PCR Primer
(F):5'- AGGGTCACTATCTAAGGCCAC -3'
(R):5'- CACCCTACGTACGTGTCATC -3'

Sequencing Primer
(F):5'- AGAACCTTGGCAGCTCCTTTAGAG -3'
(R):5'- GACAGAAGTTCTATCAGGCAA -3'
Posted On2016-11-09