Incidental Mutation 'R5668:Senp1'
ID442475
Institutional Source Beutler Lab
Gene Symbol Senp1
Ensembl Gene ENSMUSG00000033075
Gene NameSUMO1/sentrin specific peptidase 1
Synonyms2310046A20Rik, D15Ertd528e, E330036L07Rik
MMRRC Submission 043311-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5668 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location98038744-98093744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98048355 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 503 (R503H)
Ref Sequence ENSEMBL: ENSMUSP00000138056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044189] [ENSMUST00000180657] [ENSMUST00000180716]
Predicted Effect probably damaging
Transcript: ENSMUST00000044189
AA Change: R477H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046598
Gene: ENSMUSG00000033075
AA Change: R477H

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
low complexity region 183 192 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
low complexity region 357 375 N/A INTRINSIC
Pfam:Peptidase_C48 460 638 1.3e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180461
SMART Domains Protein: ENSMUSP00000137769
Gene: ENSMUSG00000033075

DomainStartEndE-ValueType
Pfam:Peptidase_C48 1 169 2.2e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180657
AA Change: R503H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138056
Gene: ENSMUSG00000033075
AA Change: R503H

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
low complexity region 183 192 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
low complexity region 383 401 N/A INTRINSIC
Pfam:Peptidase_C48 486 664 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180716
SMART Domains Protein: ENSMUSP00000138032
Gene: ENSMUSG00000033075

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181855
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cysteine protease that specifically targets members of the small ubiquitin-like modifier (SUMO) protein family. This protease regulates SUMO pathways by deconjugating sumoylated proteins. This protease also functions to process the precursor SUMO proteins into their mature form. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous mutant mice die before birth. Depending on the allele mice may exhibit placental labyrinth defects and widespread cell death or severe anemia and a defect in definitive erythropoiesis in the fetal liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,904,550 W429R probably damaging Het
Afg1l C T 10: 42,360,240 C272Y probably damaging Het
Agrn T C 4: 156,167,313 T1831A probably damaging Het
AI481877 A G 4: 59,047,399 S1407P probably benign Het
Aifm2 T C 10: 61,725,917 V14A probably damaging Het
Angptl3 A T 4: 99,032,084 probably null Het
Arfgap1 A T 2: 180,974,119 D197V possibly damaging Het
Atp1a3 T C 7: 24,978,869 probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC067074 A G 13: 113,317,167 S55G possibly damaging Het
Brwd1 T C 16: 96,016,150 I1387M probably damaging Het
Cavin4 A G 4: 48,672,499 T315A probably benign Het
Cep128 T C 12: 90,999,636 T1066A probably benign Het
Cln3 T C 7: 126,572,386 T376A probably benign Het
Cntn4 A T 6: 106,679,436 silent Het
Colec12 T A 18: 9,848,963 D380E probably damaging Het
Csmd3 T C 15: 47,695,755 I2371V possibly damaging Het
Cxcl3 T C 5: 90,787,440 S99P unknown Het
Ddx60 A G 8: 62,000,578 R1244G probably benign Het
Dhx38 T C 8: 109,553,416 D914G probably damaging Het
Dlc1 T G 8: 36,937,501 probably benign Het
Fam161b A G 12: 84,356,350 S169P probably damaging Het
Fastkd1 A G 2: 69,707,381 S286P possibly damaging Het
Fmn2 A T 1: 174,582,037 E612V unknown Het
Foxb1 T A 9: 69,760,246 M1L probably damaging Het
Gm14412 A T 2: 177,315,609 C164* probably null Het
Gm43302 T A 5: 105,275,812 M432L probably benign Het
Gm4353 C A 7: 116,083,678 A223S probably damaging Het
Gm884 T A 11: 103,617,054 probably benign Het
Gm8994 A T 6: 136,329,395 I264F probably benign Het
Gpatch8 T C 11: 102,500,867 K143R unknown Het
Gpr15 A G 16: 58,717,650 S359P probably damaging Het
Gucy2e A G 11: 69,228,381 L649P probably damaging Het
H2-M10.5 C A 17: 36,774,581 H211N probably damaging Het
Hs6st1 T C 1: 36,103,889 Y302H probably damaging Het
Khdrbs2 A T 1: 32,467,770 D165V probably damaging Het
Klra13-ps T G 6: 130,304,283 noncoding transcript Het
Lrrc37a T A 11: 103,500,175 T1475S probably benign Het
Ly75 A G 2: 60,354,500 S437P probably damaging Het
Maz C T 7: 127,025,322 C342Y probably damaging Het
Mcf2l C A 8: 13,013,812 S1008* probably null Het
Mcmbp T C 7: 128,712,754 D246G probably benign Het
Mipol1 G A 12: 57,325,560 R135H possibly damaging Het
Mycbp2 T A 14: 103,120,519 Y4613F possibly damaging Het
Nup188 G A 2: 30,336,324 A1118T probably damaging Het
Olfr1226 A T 2: 89,193,826 D69E possibly damaging Het
Olfr1249 G A 2: 89,630,344 L185F probably damaging Het
Olfr1427 A G 19: 12,098,926 S238P probably damaging Het
Olfr267 T A 4: 58,785,489 I78F probably benign Het
Olfr573-ps1 T C 7: 102,941,921 K219E probably benign Het
Olfr585 A T 7: 103,097,896 S52C probably benign Het
Olfr981 A T 9: 40,022,668 I92F probably damaging Het
P3h1 T A 4: 119,244,046 I460N possibly damaging Het
Pcnt T C 10: 76,409,500 D1101G probably benign Het
Phlpp2 C A 8: 109,928,573 Q667K possibly damaging Het
Plec A G 15: 76,190,466 F434L possibly damaging Het
Ppp6r2 T A 15: 89,280,399 I602N probably damaging Het
Rdh8 A C 9: 20,825,179 I181L probably benign Het
Rnf181 A G 6: 72,361,522 M1T probably null Het
Rpl29-ps2 A G 13: 4,614,222 noncoding transcript Het
Sart3 A G 5: 113,745,156 probably null Het
Sec14l2 A C 11: 4,109,189 L160R probably damaging Het
Slc22a2 T C 17: 12,608,409 V316A probably benign Het
Slc34a1 A T 13: 55,409,085 I365F possibly damaging Het
Spag5 T C 11: 78,304,716 V283A possibly damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Sun3 A G 11: 9,031,433 probably null Het
Syt6 A G 3: 103,620,901 Y312C probably damaging Het
Tas2r121 T A 6: 132,700,793 Y72F possibly damaging Het
Tfrc A G 16: 32,623,376 Y473C probably damaging Het
Trp63 C T 16: 25,866,185 A274V possibly damaging Het
Trpm5 T C 7: 143,073,229 D1085G probably benign Het
Ttn A G 2: 76,914,664 V5347A probably benign Het
Vma21-ps T A 4: 52,496,946 Q100L possibly damaging Het
Vmn2r22 T C 6: 123,637,914 N239S probably benign Het
Wfdc8 T C 2: 164,597,419 probably benign Het
Xkr4 T A 1: 3,671,035 Y105F probably damaging Het
Xpo7 C T 14: 70,682,846 V627I possibly damaging Het
Zfp606 T C 7: 12,492,552 V200A probably benign Het
Zfp936 A T 7: 43,190,434 S441C possibly damaging Het
Other mutations in Senp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Senp1 APN 15 98064838 missense probably damaging 1.00
IGL01431:Senp1 APN 15 98082263 missense probably damaging 0.97
IGL02674:Senp1 APN 15 98056959 missense probably damaging 0.99
IGL03289:Senp1 APN 15 98085045 missense probably damaging 1.00
Calmate UTSW 15 98066498 missense probably benign 0.00
mustard UTSW 15 98048271 missense probably damaging 1.00
nitrogen UTSW 15 98066531 missense possibly damaging 0.61
Sinapis UTSW 15 98064880 splice site probably benign
PIT1430001:Senp1 UTSW 15 98084989 missense probably damaging 1.00
R0026:Senp1 UTSW 15 98076668 missense probably damaging 0.99
R0026:Senp1 UTSW 15 98076668 missense probably damaging 0.99
R0125:Senp1 UTSW 15 98048231 missense probably damaging 0.99
R0531:Senp1 UTSW 15 98064880 splice site probably benign
R1389:Senp1 UTSW 15 98075853 missense probably benign 0.03
R1396:Senp1 UTSW 15 98076554 missense probably benign 0.01
R1786:Senp1 UTSW 15 98075967 missense probably benign 0.00
R1999:Senp1 UTSW 15 98058315 missense possibly damaging 0.61
R2045:Senp1 UTSW 15 98059944 missense possibly damaging 0.57
R2130:Senp1 UTSW 15 98075967 missense probably benign 0.00
R2132:Senp1 UTSW 15 98075967 missense probably benign 0.00
R2133:Senp1 UTSW 15 98075967 missense probably benign 0.00
R2150:Senp1 UTSW 15 98058315 missense possibly damaging 0.61
R2327:Senp1 UTSW 15 98082284 missense probably damaging 1.00
R3815:Senp1 UTSW 15 98056832 missense probably damaging 1.00
R4719:Senp1 UTSW 15 98056850 missense probably benign 0.42
R4766:Senp1 UTSW 15 98045896 missense probably damaging 0.98
R4866:Senp1 UTSW 15 98066848 missense possibly damaging 0.93
R5141:Senp1 UTSW 15 98076607 missense probably benign 0.08
R5485:Senp1 UTSW 15 98066496 missense probably benign 0.00
R5651:Senp1 UTSW 15 98076617 missense probably benign
R5729:Senp1 UTSW 15 98066531 missense possibly damaging 0.61
R6041:Senp1 UTSW 15 98058216 missense probably damaging 0.97
R6395:Senp1 UTSW 15 98048193 missense probably damaging 1.00
R6521:Senp1 UTSW 15 98048271 missense probably damaging 1.00
R7070:Senp1 UTSW 15 98082306 missense possibly damaging 0.66
R7075:Senp1 UTSW 15 98058326 missense probably benign 0.00
R7262:Senp1 UTSW 15 98066498 missense probably benign 0.00
R7625:Senp1 UTSW 15 98066798 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CTCACAGCTAGACACCAGTG -3'
(R):5'- TTCCAGCAGTTAACTTAGTTGTGTG -3'

Sequencing Primer
(F):5'- GCTAGACACCAGTGCACAC -3'
(R):5'- AGCATTCGTTGAGTTGGC -3'
Posted On2016-11-09