Incidental Mutation 'R5668:Brwd1'
ID442479
Institutional Source Beutler Lab
Gene Symbol Brwd1
Ensembl Gene ENSMUSG00000022914
Gene Namebromodomain and WD repeat domain containing 1
SynonymsG1-403-16, repro5, D530019K20Rik, 5330419I02Rik, Wdr9
MMRRC Submission 043311-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5668 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location95992092-96082428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96016150 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 1387 (I1387M)
Ref Sequence ENSEMBL: ENSMUSP00000097101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023631] [ENSMUST00000099502] [ENSMUST00000113829] [ENSMUST00000131322] [ENSMUST00000153398]
Predicted Effect probably damaging
Transcript: ENSMUST00000023631
AA Change: I1387M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023631
Gene: ENSMUSG00000022914
AA Change: I1387M

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099502
AA Change: I1387M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097101
Gene: ENSMUSG00000022914
AA Change: I1387M

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113829
AA Change: I1387M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109460
Gene: ENSMUSG00000022914
AA Change: I1387M

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.13e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.13e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2177 2188 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130823
Predicted Effect probably benign
Transcript: ENSMUST00000131322
SMART Domains Protein: ENSMUSP00000118327
Gene: ENSMUSG00000022914

DomainStartEndE-ValueType
low complexity region 107 123 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 353 374 N/A INTRINSIC
Blast:BROMO 496 582 4e-37 BLAST
Blast:BROMO 603 627 5e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147655
Predicted Effect
SMART Domains Protein: ENSMUSP00000122457
Gene: ENSMUSG00000022914
AA Change: I231M

DomainStartEndE-ValueType
BROMO 49 160 1.72e-6 SMART
BROMO 164 267 8.06e-12 SMART
low complexity region 342 358 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153398
AA Change: I1387M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117066
Gene: ENSMUSG00000022914
AA Change: I1387M

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
internal_repeat_1 1491 1957 1.45e-251 PROSPERO
internal_repeat_1 1956 2422 1.45e-251 PROSPERO
low complexity region 2630 2639 N/A INTRINSIC
Meta Mutation Damage Score 0.4237 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) residues which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 2 bromodomains and multiple WD repeats. This gene is located within the Down syndrome region-2 on chromosome 21. Alternative splicing of this gene generates multiple transcript variants encoding distinct isoforms. In mouse, this gene encodes a nuclear protein that has a polyglutamine-containing region that functions as a transcriptional activation domain which may regulate chromatin remodelling and associates with a component of the SWI/SNF chromatin remodelling complex.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous males and females are infertile. Spermiogenesis is impaired; males have low epididymal sperm concentration with low motility and abnormal sperm head morphology. Female oocytes commonly contain vacuoles and have low developmental competence to 2-cell and blastocyst stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,904,550 W429R probably damaging Het
Afg1l C T 10: 42,360,240 C272Y probably damaging Het
Agrn T C 4: 156,167,313 T1831A probably damaging Het
AI481877 A G 4: 59,047,399 S1407P probably benign Het
Aifm2 T C 10: 61,725,917 V14A probably damaging Het
Angptl3 A T 4: 99,032,084 probably null Het
Arfgap1 A T 2: 180,974,119 D197V possibly damaging Het
Atp1a3 T C 7: 24,978,869 probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC067074 A G 13: 113,317,167 S55G possibly damaging Het
Cavin4 A G 4: 48,672,499 T315A probably benign Het
Cep128 T C 12: 90,999,636 T1066A probably benign Het
Cln3 T C 7: 126,572,386 T376A probably benign Het
Cntn4 A T 6: 106,679,436 silent Het
Colec12 T A 18: 9,848,963 D380E probably damaging Het
Csmd3 T C 15: 47,695,755 I2371V possibly damaging Het
Cxcl3 T C 5: 90,787,440 S99P unknown Het
Ddx60 A G 8: 62,000,578 R1244G probably benign Het
Dhx38 T C 8: 109,553,416 D914G probably damaging Het
Dlc1 T G 8: 36,937,501 probably benign Het
Fam161b A G 12: 84,356,350 S169P probably damaging Het
Fastkd1 A G 2: 69,707,381 S286P possibly damaging Het
Fmn2 A T 1: 174,582,037 E612V unknown Het
Foxb1 T A 9: 69,760,246 M1L probably damaging Het
Gm14412 A T 2: 177,315,609 C164* probably null Het
Gm43302 T A 5: 105,275,812 M432L probably benign Het
Gm4353 C A 7: 116,083,678 A223S probably damaging Het
Gm884 T A 11: 103,617,054 probably benign Het
Gm8994 A T 6: 136,329,395 I264F probably benign Het
Gpatch8 T C 11: 102,500,867 K143R unknown Het
Gpr15 A G 16: 58,717,650 S359P probably damaging Het
Gucy2e A G 11: 69,228,381 L649P probably damaging Het
H2-M10.5 C A 17: 36,774,581 H211N probably damaging Het
Hs6st1 T C 1: 36,103,889 Y302H probably damaging Het
Khdrbs2 A T 1: 32,467,770 D165V probably damaging Het
Klra13-ps T G 6: 130,304,283 noncoding transcript Het
Lrrc37a T A 11: 103,500,175 T1475S probably benign Het
Ly75 A G 2: 60,354,500 S437P probably damaging Het
Maz C T 7: 127,025,322 C342Y probably damaging Het
Mcf2l C A 8: 13,013,812 S1008* probably null Het
Mcmbp T C 7: 128,712,754 D246G probably benign Het
Mipol1 G A 12: 57,325,560 R135H possibly damaging Het
Mycbp2 T A 14: 103,120,519 Y4613F possibly damaging Het
Nup188 G A 2: 30,336,324 A1118T probably damaging Het
Olfr1226 A T 2: 89,193,826 D69E possibly damaging Het
Olfr1249 G A 2: 89,630,344 L185F probably damaging Het
Olfr1427 A G 19: 12,098,926 S238P probably damaging Het
Olfr267 T A 4: 58,785,489 I78F probably benign Het
Olfr573-ps1 T C 7: 102,941,921 K219E probably benign Het
Olfr585 A T 7: 103,097,896 S52C probably benign Het
Olfr981 A T 9: 40,022,668 I92F probably damaging Het
P3h1 T A 4: 119,244,046 I460N possibly damaging Het
Pcnt T C 10: 76,409,500 D1101G probably benign Het
Phlpp2 C A 8: 109,928,573 Q667K possibly damaging Het
Plec A G 15: 76,190,466 F434L possibly damaging Het
Ppp6r2 T A 15: 89,280,399 I602N probably damaging Het
Rdh8 A C 9: 20,825,179 I181L probably benign Het
Rnf181 A G 6: 72,361,522 M1T probably null Het
Rpl29-ps2 A G 13: 4,614,222 noncoding transcript Het
Sart3 A G 5: 113,745,156 probably null Het
Sec14l2 A C 11: 4,109,189 L160R probably damaging Het
Senp1 C T 15: 98,048,355 R503H probably damaging Het
Slc22a2 T C 17: 12,608,409 V316A probably benign Het
Slc34a1 A T 13: 55,409,085 I365F possibly damaging Het
Spag5 T C 11: 78,304,716 V283A possibly damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Sun3 A G 11: 9,031,433 probably null Het
Syt6 A G 3: 103,620,901 Y312C probably damaging Het
Tas2r121 T A 6: 132,700,793 Y72F possibly damaging Het
Tfrc A G 16: 32,623,376 Y473C probably damaging Het
Trp63 C T 16: 25,866,185 A274V possibly damaging Het
Trpm5 T C 7: 143,073,229 D1085G probably benign Het
Ttn A G 2: 76,914,664 V5347A probably benign Het
Vma21-ps T A 4: 52,496,946 Q100L possibly damaging Het
Vmn2r22 T C 6: 123,637,914 N239S probably benign Het
Wfdc8 T C 2: 164,597,419 probably benign Het
Xkr4 T A 1: 3,671,035 Y105F probably damaging Het
Xpo7 C T 14: 70,682,846 V627I possibly damaging Het
Zfp606 T C 7: 12,492,552 V200A probably benign Het
Zfp936 A T 7: 43,190,434 S441C possibly damaging Het
Other mutations in Brwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Brwd1 APN 16 96017586 missense probably damaging 1.00
IGL00974:Brwd1 APN 16 96043026 missense probably damaging 1.00
IGL01014:Brwd1 APN 16 96016173 missense probably benign 0.04
IGL01447:Brwd1 APN 16 96047379 nonsense probably null
IGL01459:Brwd1 APN 16 96047420 missense probably damaging 1.00
IGL01631:Brwd1 APN 16 96046466 missense probably damaging 1.00
IGL02184:Brwd1 APN 16 96013829 missense probably damaging 1.00
IGL02264:Brwd1 APN 16 96019456 missense probably damaging 0.98
IGL02679:Brwd1 APN 16 96002823 missense probably benign
IGL02833:Brwd1 APN 16 96052571 missense probably damaging 1.00
IGL02960:Brwd1 APN 16 96057466 missense probably damaging 1.00
IGL03053:Brwd1 APN 16 96017677 missense possibly damaging 0.75
IGL03074:Brwd1 APN 16 96011850 missense probably benign 0.00
IGL03135:Brwd1 APN 16 96021258 missense probably damaging 0.99
IGL03168:Brwd1 APN 16 96017677 missense possibly damaging 0.75
IGL03214:Brwd1 APN 16 96037900 missense probably benign 0.26
IGL03328:Brwd1 APN 16 96002725 missense probably damaging 0.99
Embers UTSW 16 96017604 missense probably damaging 1.00
Glowing UTSW 16 96035959 missense probably damaging 1.00
PIT4243001:Brwd1 UTSW 16 96002671 nonsense probably null
R0012:Brwd1 UTSW 16 96059652 missense probably damaging 0.98
R0012:Brwd1 UTSW 16 96059652 missense probably damaging 0.98
R0030:Brwd1 UTSW 16 96021256 missense probably damaging 1.00
R0135:Brwd1 UTSW 16 96047104 missense probably damaging 1.00
R0366:Brwd1 UTSW 16 96037964 nonsense probably null
R0551:Brwd1 UTSW 16 96035974 missense probably damaging 1.00
R0586:Brwd1 UTSW 16 96043086 missense probably damaging 1.00
R0865:Brwd1 UTSW 16 96068584 missense probably damaging 1.00
R1226:Brwd1 UTSW 16 96031548 missense probably benign 0.35
R1329:Brwd1 UTSW 16 96003234 missense probably benign 0.07
R1378:Brwd1 UTSW 16 96041370 missense probably benign 0.06
R1420:Brwd1 UTSW 16 96036034 missense probably damaging 1.00
R1441:Brwd1 UTSW 16 96066151 missense probably damaging 0.99
R1484:Brwd1 UTSW 16 96028291 unclassified probably null
R1624:Brwd1 UTSW 16 96008144 missense possibly damaging 0.67
R1636:Brwd1 UTSW 16 96059641 missense probably damaging 1.00
R1988:Brwd1 UTSW 16 96021237 missense probably damaging 0.96
R1998:Brwd1 UTSW 16 96021288 missense probably damaging 1.00
R2066:Brwd1 UTSW 16 96046465 missense probably benign 0.01
R2898:Brwd1 UTSW 16 96066100 missense probably damaging 0.99
R2983:Brwd1 UTSW 16 96066574 missense probably damaging 0.98
R3966:Brwd1 UTSW 16 96044530 missense probably damaging 1.00
R4086:Brwd1 UTSW 16 96046372 missense probably benign 0.03
R4257:Brwd1 UTSW 16 96023496 missense probably damaging 1.00
R4290:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4292:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4293:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4614:Brwd1 UTSW 16 96047359 missense probably damaging 1.00
R4771:Brwd1 UTSW 16 96003318 missense probably benign 0.00
R5025:Brwd1 UTSW 16 96053972 missense probably damaging 0.97
R5155:Brwd1 UTSW 16 96002793 nonsense probably null
R5229:Brwd1 UTSW 16 96002209 missense possibly damaging 0.87
R5246:Brwd1 UTSW 16 96002557 missense probably damaging 1.00
R5763:Brwd1 UTSW 16 96033843 nonsense probably null
R5782:Brwd1 UTSW 16 96043043 nonsense probably null
R5831:Brwd1 UTSW 16 96019436 missense probably damaging 1.00
R5836:Brwd1 UTSW 16 96064758 missense probably damaging 1.00
R5906:Brwd1 UTSW 16 96058738 missense probably damaging 1.00
R5995:Brwd1 UTSW 16 96064787 missense probably damaging 1.00
R6143:Brwd1 UTSW 16 96002956 missense probably benign 0.00
R6241:Brwd1 UTSW 16 96013874 missense probably damaging 1.00
R6313:Brwd1 UTSW 16 96007941 missense probably benign 0.01
R6362:Brwd1 UTSW 16 96002307 missense probably damaging 1.00
R6551:Brwd1 UTSW 16 95993962 missense possibly damaging 0.55
R6736:Brwd1 UTSW 16 96068572 missense probably damaging 1.00
R6822:Brwd1 UTSW 16 96041274 missense probably benign 0.42
R7080:Brwd1 UTSW 16 96009530 missense probably benign 0.01
R7131:Brwd1 UTSW 16 96066498 missense probably damaging 1.00
R7208:Brwd1 UTSW 16 96035959 missense probably damaging 1.00
R7322:Brwd1 UTSW 16 96066119 missense probably damaging 1.00
R7483:Brwd1 UTSW 16 96056173 missense probably damaging 0.99
R7615:Brwd1 UTSW 16 96033839 missense probably damaging 0.96
R7621:Brwd1 UTSW 16 96064887 missense probably damaging 1.00
R7665:Brwd1 UTSW 16 96041343 missense probably benign 0.09
R7697:Brwd1 UTSW 16 96046401 missense probably benign 0.10
R7740:Brwd1 UTSW 16 96027368 missense probably damaging 1.00
X0017:Brwd1 UTSW 16 96044491 missense probably damaging 1.00
X0028:Brwd1 UTSW 16 96011923 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CAGCTTTGCTCATCCCAGAC -3'
(R):5'- GGCATTGTACGCATATCCTAAC -3'

Sequencing Primer
(F):5'- CCAGACATCTTGTGTTTATCCAG -3'
(R):5'- AGAAGAGTTGCTGAGTTCCCC -3'
Posted On2016-11-09