Incidental Mutation 'R5669:Olfr1115'
ID442490
Institutional Source Beutler Lab
Gene Symbol Olfr1115
Ensembl Gene ENSMUSG00000070856
Gene Nameolfactory receptor 1115
SynonymsMOR264-20, MOR273-4P, MOR273-4P, Olfr1530-ps1, GA_x6K02T2Q125-48736906-48737886
MMRRC Submission 043312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5669 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87248013-87253868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87252441 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 168 (V168A)
Ref Sequence ENSEMBL: ENSMUSP00000150996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081986] [ENSMUST00000213513] [ENSMUST00000214119] [ENSMUST00000217196]
Predicted Effect probably benign
Transcript: ENSMUST00000081986
AA Change: V168A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000080647
Gene: ENSMUSG00000070856
AA Change: V168A

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 5e-54 PFAM
Pfam:7tm_1 56 305 3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183480
Predicted Effect probably benign
Transcript: ENSMUST00000213513
AA Change: V168A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000214119
AA Change: V168A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000217196
AA Change: V168A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Akap9 T A 5: 4,050,540 L2734* probably null Het
Aldh1a1 T C 19: 20,610,920 I25T probably damaging Het
Astl G T 2: 127,347,279 R175L probably damaging Het
BC035947 A T 1: 78,497,913 C661S probably damaging Het
Cd160 C T 3: 96,808,898 probably benign Het
Cdc42bpb C T 12: 111,302,013 probably null Het
Cdip1 T A 16: 4,768,815 I149F probably damaging Het
Cfap65 T C 1: 74,924,968 Y607C probably damaging Het
Col6a5 A G 9: 105,925,998 I1256T unknown Het
Copb1 A G 7: 114,237,585 V336A probably damaging Het
Ddx42 A T 11: 106,241,819 D556V probably damaging Het
Dlk1 T C 12: 109,460,038 V279A probably benign Het
Fbll1 T C 11: 35,797,584 N284S probably benign Het
Fbxw21 A T 9: 109,145,510 I314N probably benign Het
Foxa3 T C 7: 19,014,251 T317A probably benign Het
Gm14139 A G 2: 150,192,178 I140V probably benign Het
Gpr37 A T 6: 25,669,352 C498S probably benign Het
Hapln3 G T 7: 79,117,496 probably null Het
Igkv4-54 A G 6: 69,631,848 V29A possibly damaging Het
Itgb8 T A 12: 119,190,628 I225F probably damaging Het
Kcnk3 A G 5: 30,622,349 T248A probably damaging Het
Kcnv1 T C 15: 45,114,252 Q130R possibly damaging Het
Lrp1b T C 2: 41,111,038 H2058R probably damaging Het
Macf1 T A 4: 123,476,225 E1581V probably damaging Het
Mga A G 2: 119,903,426 N252D probably damaging Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Olfr58 T C 9: 19,783,757 F208S probably benign Het
Pak7 G A 2: 136,116,284 P295S probably damaging Het
Pcsk1 T A 13: 75,130,102 S595T probably benign Het
Pepd T C 7: 35,040,674 V324A probably benign Het
Pml C T 9: 58,247,063 D176N probably benign Het
Popdc3 T A 10: 45,316,433 I163N probably damaging Het
Ppp1r13l A C 7: 19,373,022 T481P probably benign Het
Pramef12 T C 4: 144,395,843 I44V probably benign Het
Prlh A G 1: 90,953,120 T5A probably benign Het
Prom1 A G 5: 44,012,943 F638S possibly damaging Het
Prpf8 T A 11: 75,504,738 L1897H probably damaging Het
Ret T C 6: 118,184,243 T91A probably benign Het
Retsat A G 6: 72,606,010 S176G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,458,785 L3823P possibly damaging Het
Rnf31 C T 14: 55,596,704 A653V probably damaging Het
Rps6kl1 T C 12: 85,147,867 D90G probably damaging Het
Scarb1 A G 5: 125,300,387 Y194H probably damaging Het
Scube2 C T 7: 109,825,439 A556T probably benign Het
Serpinb1a A G 13: 32,845,316 L243P probably damaging Het
Slc39a4 A C 15: 76,614,163 L358R probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Srgap1 C A 10: 121,804,850 V681L probably benign Het
Tmprss6 A T 15: 78,454,956 M262K possibly damaging Het
Ttf2 T A 3: 100,951,117 K719* probably null Het
Vmn1r62 T A 7: 5,675,737 L139* probably null Het
Other mutations in Olfr1115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Olfr1115 APN 2 87252462 missense probably damaging 1.00
IGL01376:Olfr1115 APN 2 87252873 missense possibly damaging 0.58
IGL02167:Olfr1115 APN 2 87252198 missense probably benign 0.18
IGL02224:Olfr1115 APN 2 87252477 missense probably benign 0.42
IGL02388:Olfr1115 APN 2 87251951 missense probably benign
IGL02596:Olfr1115 APN 2 87252129 missense probably damaging 0.98
PIT4131001:Olfr1115 UTSW 2 87252629 missense probably benign 0.01
R0140:Olfr1115 UTSW 2 87252625 missense probably damaging 1.00
R0468:Olfr1115 UTSW 2 87252255 missense probably benign 0.04
R1222:Olfr1115 UTSW 2 87252422 missense probably benign 0.04
R1418:Olfr1115 UTSW 2 87252422 missense probably benign 0.04
R1742:Olfr1115 UTSW 2 87252778 missense probably benign 0.01
R1822:Olfr1115 UTSW 2 87252710 missense possibly damaging 0.91
R2332:Olfr1115 UTSW 2 87252873 missense possibly damaging 0.58
R3123:Olfr1115 UTSW 2 87252791 missense possibly damaging 0.67
R3407:Olfr1115 UTSW 2 87252899 missense probably benign 0.00
R4571:Olfr1115 UTSW 2 87252458 missense possibly damaging 0.67
R4710:Olfr1115 UTSW 2 87252040 missense possibly damaging 0.64
R4889:Olfr1115 UTSW 2 87252647 missense probably damaging 0.97
R5031:Olfr1115 UTSW 2 87252082 missense probably benign
R5288:Olfr1115 UTSW 2 87252483 missense probably benign 0.06
R5385:Olfr1115 UTSW 2 87252483 missense probably benign 0.06
R5386:Olfr1115 UTSW 2 87252483 missense probably benign 0.06
R6187:Olfr1115 UTSW 2 87252698 missense probably damaging 1.00
R6226:Olfr1115 UTSW 2 87252392 missense probably benign 0.27
R6598:Olfr1115 UTSW 2 87252756 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCTGTGCTACACAAATGTG -3'
(R):5'- TGATGGCAACTTCAAGATAGTTGAG -3'

Sequencing Primer
(F):5'- CAAATGTGTTTATTCCTTATCCTGGG -3'
(R):5'- TGATCCTGCTGTAAGATGCAAG -3'
Posted On2016-11-09