Incidental Mutation 'R5669:Pak7'
List |< first << previous [record 31 of 55] next >> last >|
ID442493
Institutional Source Beutler Lab
Gene Symbol Pak7
Ensembl Gene ENSMUSG00000039913
Gene Namep21 (RAC1) activated kinase 7
Synonyms2900083L08Rik, Pak5
MMRRC Submission 043312-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5669 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location136081104-136387967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 136116284 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 295 (P295S)
Ref Sequence ENSEMBL: ENSMUSP00000076440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035264] [ENSMUST00000077200]
Predicted Effect probably damaging
Transcript: ENSMUST00000035264
AA Change: P295S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047285
Gene: ENSMUSG00000039913
AA Change: P295S

DomainStartEndE-ValueType
PBD 11 46 5.3e-13 SMART
low complexity region 394 415 N/A INTRINSIC
S_TKc 449 700 1.39e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077200
AA Change: P295S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076440
Gene: ENSMUSG00000039913
AA Change: P295S

DomainStartEndE-ValueType
PBD 11 46 5.3e-13 SMART
low complexity region 394 415 N/A INTRINSIC
S_TKc 449 700 1.39e-90 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PAK family of Ser/Thr protein kinases. PAK family members are known to be effectors of Rac/Cdc42 GTPases, which have been implicated in the regulation of cytoskeletal dynamics, proliferation, and cell survival signaling. This kinase contains a CDC42/Rac1 interactive binding (CRIB) motif, and has been shown to bind CDC42 in the presence of GTP. This kinase is predominantly expressed in brain. It is capable of promoting neurite outgrowth, and thus may play a role in neurite development. This kinase is associated with microtubule networks and induces microtubule stabilization. The subcellular localization of this kinase is tightly regulated during cell cycle progression. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit impaired active avoidance learning but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Akap9 T A 5: 4,050,540 L2734* probably null Het
Aldh1a1 T C 19: 20,610,920 I25T probably damaging Het
Astl G T 2: 127,347,279 R175L probably damaging Het
BC035947 A T 1: 78,497,913 C661S probably damaging Het
Cd160 C T 3: 96,808,898 probably benign Het
Cdc42bpb C T 12: 111,302,013 probably null Het
Cdip1 T A 16: 4,768,815 I149F probably damaging Het
Cfap65 T C 1: 74,924,968 Y607C probably damaging Het
Col6a5 A G 9: 105,925,998 I1256T unknown Het
Copb1 A G 7: 114,237,585 V336A probably damaging Het
Ddx42 A T 11: 106,241,819 D556V probably damaging Het
Dlk1 T C 12: 109,460,038 V279A probably benign Het
Fbll1 T C 11: 35,797,584 N284S probably benign Het
Fbxw21 A T 9: 109,145,510 I314N probably benign Het
Foxa3 T C 7: 19,014,251 T317A probably benign Het
Gm14139 A G 2: 150,192,178 I140V probably benign Het
Gpr37 A T 6: 25,669,352 C498S probably benign Het
Hapln3 G T 7: 79,117,496 probably null Het
Igkv4-54 A G 6: 69,631,848 V29A possibly damaging Het
Itgb8 T A 12: 119,190,628 I225F probably damaging Het
Kcnk3 A G 5: 30,622,349 T248A probably damaging Het
Kcnv1 T C 15: 45,114,252 Q130R possibly damaging Het
Lrp1b T C 2: 41,111,038 H2058R probably damaging Het
Macf1 T A 4: 123,476,225 E1581V probably damaging Het
Mga A G 2: 119,903,426 N252D probably damaging Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Olfr1115 T C 2: 87,252,441 V168A probably benign Het
Olfr58 T C 9: 19,783,757 F208S probably benign Het
Pcsk1 T A 13: 75,130,102 S595T probably benign Het
Pepd T C 7: 35,040,674 V324A probably benign Het
Pml C T 9: 58,247,063 D176N probably benign Het
Popdc3 T A 10: 45,316,433 I163N probably damaging Het
Ppp1r13l A C 7: 19,373,022 T481P probably benign Het
Pramef12 T C 4: 144,395,843 I44V probably benign Het
Prlh A G 1: 90,953,120 T5A probably benign Het
Prom1 A G 5: 44,012,943 F638S possibly damaging Het
Prpf8 T A 11: 75,504,738 L1897H probably damaging Het
Ret T C 6: 118,184,243 T91A probably benign Het
Retsat A G 6: 72,606,010 S176G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,458,785 L3823P possibly damaging Het
Rnf31 C T 14: 55,596,704 A653V probably damaging Het
Rps6kl1 T C 12: 85,147,867 D90G probably damaging Het
Scarb1 A G 5: 125,300,387 Y194H probably damaging Het
Scube2 C T 7: 109,825,439 A556T probably benign Het
Serpinb1a A G 13: 32,845,316 L243P probably damaging Het
Slc39a4 A C 15: 76,614,163 L358R probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Srgap1 C A 10: 121,804,850 V681L probably benign Het
Tmprss6 A T 15: 78,454,956 M262K possibly damaging Het
Ttf2 T A 3: 100,951,117 K719* probably null Het
Vmn1r62 T A 7: 5,675,737 L139* probably null Het
Other mutations in Pak7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Pak7 APN 2 136116373 missense possibly damaging 0.89
IGL01743:Pak7 APN 2 136087413 missense probably damaging 1.00
IGL02601:Pak7 APN 2 136116935 nonsense probably null
IGL03172:Pak7 APN 2 136098390 nonsense probably null
currency UTSW 2 136100939 missense probably benign 0.15
Depreciation UTSW 2 136097534 missense probably damaging 1.00
PIT4498001:Pak7 UTSW 2 136083291 missense probably damaging 1.00
R0025:Pak7 UTSW 2 136100784 missense possibly damaging 0.68
R0025:Pak7 UTSW 2 136100784 missense possibly damaging 0.68
R0400:Pak7 UTSW 2 136097579 missense possibly damaging 0.95
R0441:Pak7 UTSW 2 136116629 missense probably benign
R1653:Pak7 UTSW 2 136116887 missense probably damaging 1.00
R1662:Pak7 UTSW 2 136116760 missense probably damaging 0.96
R1855:Pak7 UTSW 2 136087509 missense probably benign 0.00
R1872:Pak7 UTSW 2 136085588 missense possibly damaging 0.93
R2001:Pak7 UTSW 2 136116637 missense probably benign 0.00
R2002:Pak7 UTSW 2 136116637 missense probably benign 0.00
R2157:Pak7 UTSW 2 136100957 missense probably damaging 0.96
R2160:Pak7 UTSW 2 136098382 missense probably benign 0.01
R2217:Pak7 UTSW 2 136116203 missense probably damaging 1.00
R3797:Pak7 UTSW 2 136100826 missense probably benign 0.06
R4711:Pak7 UTSW 2 136087517 missense probably damaging 1.00
R4904:Pak7 UTSW 2 136083347 missense probably benign 0.02
R5090:Pak7 UTSW 2 136087418 missense probably damaging 1.00
R5120:Pak7 UTSW 2 136083229 missense probably damaging 0.97
R5954:Pak7 UTSW 2 136116463 missense probably benign 0.01
R6127:Pak7 UTSW 2 136087406 missense probably damaging 0.99
R6250:Pak7 UTSW 2 136174269 start gained probably benign
R6471:Pak7 UTSW 2 136116190 missense probably benign 0.00
R6797:Pak7 UTSW 2 136097534 missense probably damaging 1.00
R6809:Pak7 UTSW 2 136097581 missense possibly damaging 0.83
R6945:Pak7 UTSW 2 136100939 missense probably benign 0.15
R7254:Pak7 UTSW 2 136116764 missense possibly damaging 0.50
R7265:Pak7 UTSW 2 136101185 missense probably benign 0.03
R7335:Pak7 UTSW 2 136098299 missense probably damaging 1.00
R7511:Pak7 UTSW 2 136083324 missense possibly damaging 0.87
R7573:Pak7 UTSW 2 136116305 missense probably damaging 1.00
R7593:Pak7 UTSW 2 136100964 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AGATGCTGGCCATGTAGAGC -3'
(R):5'- AGAGAGCCTCTAGTAGCTCC -3'

Sequencing Primer
(F):5'- TGGAATGCACATTGTGGG -3'
(R):5'- TCACGCCTTCTAGAACTGCAGG -3'
Posted On2016-11-09