Incidental Mutation 'R5669:Gpr37'
ID 442503
Institutional Source Beutler Lab
Gene Symbol Gpr37
Ensembl Gene ENSMUSG00000039904
Gene Name G protein-coupled receptor 37
Synonyms parkin-associated endothelin B-like receptor, Pael-R
MMRRC Submission 043312-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.144) question?
Stock # R5669 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 25665878-25690729 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25669352 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 498 (C498S)
Ref Sequence ENSEMBL: ENSMUSP00000052185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054867] [ENSMUST00000200812]
AlphaFold Q9QY42
Predicted Effect probably benign
Transcript: ENSMUST00000054867
AA Change: C498S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000052185
Gene: ENSMUSG00000039904
AA Change: C498S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Pfam:7tm_1 265 536 5.2e-33 PFAM
low complexity region 549 558 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200812
SMART Domains Protein: ENSMUSP00000144683
Gene: ENSMUSG00000039904

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Pfam:7tm_1 265 421 3.4e-26 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G protein-coupled receptor family. The encoded protein contains seven transmembrane domains and is found in cell and endoplasmic reticulum membranes. G protein-coupled receptors are involved in translating outside signals into G protein mediated intracellular effects. This gene product interacts with Parkin and is involved in juvenile Parkinson disease. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit reduced striatal dopamine content, enhanced amphetamine sensitivity, reduced motor activity and coordination and increased percentage of body fat in females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Akap9 T A 5: 4,050,540 L2734* probably null Het
Aldh1a1 T C 19: 20,610,920 I25T probably damaging Het
Astl G T 2: 127,347,279 R175L probably damaging Het
BC035947 A T 1: 78,497,913 C661S probably damaging Het
Cd160 C T 3: 96,808,898 probably benign Het
Cdc42bpb C T 12: 111,302,013 probably null Het
Cdip1 T A 16: 4,768,815 I149F probably damaging Het
Cfap65 T C 1: 74,924,968 Y607C probably damaging Het
Col6a5 A G 9: 105,925,998 I1256T unknown Het
Copb1 A G 7: 114,237,585 V336A probably damaging Het
Ddx42 A T 11: 106,241,819 D556V probably damaging Het
Dlk1 T C 12: 109,460,038 V279A probably benign Het
Fbll1 T C 11: 35,797,584 N284S probably benign Het
Fbxw21 A T 9: 109,145,510 I314N probably benign Het
Foxa3 T C 7: 19,014,251 T317A probably benign Het
Gm14139 A G 2: 150,192,178 I140V probably benign Het
Hapln3 G T 7: 79,117,496 probably null Het
Igkv4-54 A G 6: 69,631,848 V29A possibly damaging Het
Itgb8 T A 12: 119,190,628 I225F probably damaging Het
Kcnk3 A G 5: 30,622,349 T248A probably damaging Het
Kcnv1 T C 15: 45,114,252 Q130R possibly damaging Het
Lrp1b T C 2: 41,111,038 H2058R probably damaging Het
Macf1 T A 4: 123,476,225 E1581V probably damaging Het
Mga A G 2: 119,903,426 N252D probably damaging Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Olfr1115 T C 2: 87,252,441 V168A probably benign Het
Olfr58 T C 9: 19,783,757 F208S probably benign Het
Pak7 G A 2: 136,116,284 P295S probably damaging Het
Pcsk1 T A 13: 75,130,102 S595T probably benign Het
Pepd T C 7: 35,040,674 V324A probably benign Het
Pml C T 9: 58,247,063 D176N probably benign Het
Popdc3 T A 10: 45,316,433 I163N probably damaging Het
Ppp1r13l A C 7: 19,373,022 T481P probably benign Het
Pramef12 T C 4: 144,395,843 I44V probably benign Het
Prlh A G 1: 90,953,120 T5A probably benign Het
Prom1 A G 5: 44,012,943 F638S possibly damaging Het
Prpf8 T A 11: 75,504,738 L1897H probably damaging Het
Ret T C 6: 118,184,243 T91A probably benign Het
Retsat A G 6: 72,606,010 S176G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,458,785 L3823P possibly damaging Het
Rnf31 C T 14: 55,596,704 A653V probably damaging Het
Rps6kl1 T C 12: 85,147,867 D90G probably damaging Het
Scarb1 A G 5: 125,300,387 Y194H probably damaging Het
Scube2 C T 7: 109,825,439 A556T probably benign Het
Serpinb1a A G 13: 32,845,316 L243P probably damaging Het
Slc39a4 A C 15: 76,614,163 L358R probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Srgap1 C A 10: 121,804,850 V681L probably benign Het
Tmprss6 A T 15: 78,454,956 M262K possibly damaging Het
Ttf2 T A 3: 100,951,117 K719* probably null Het
Vmn1r62 T A 7: 5,675,737 L139* probably null Het
Other mutations in Gpr37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Gpr37 APN 6 25669318 missense possibly damaging 0.65
IGL01595:Gpr37 APN 6 25669573 missense probably damaging 1.00
IGL01670:Gpr37 APN 6 25669834 missense probably damaging 1.00
IGL02552:Gpr37 APN 6 25688687 missense probably benign 0.05
IGL03331:Gpr37 APN 6 25669729 missense probably benign 0.26
R0375:Gpr37 UTSW 6 25669291 missense probably benign 0.08
R0534:Gpr37 UTSW 6 25669824 nonsense probably null
R0892:Gpr37 UTSW 6 25688207 missense probably damaging 1.00
R1481:Gpr37 UTSW 6 25669138 missense probably damaging 0.99
R1700:Gpr37 UTSW 6 25669624 missense probably benign 0.09
R2083:Gpr37 UTSW 6 25688417 missense possibly damaging 0.62
R2089:Gpr37 UTSW 6 25689063 missense possibly damaging 0.73
R2091:Gpr37 UTSW 6 25689063 missense possibly damaging 0.73
R2091:Gpr37 UTSW 6 25689063 missense possibly damaging 0.73
R2112:Gpr37 UTSW 6 25669381 missense possibly damaging 0.91
R2847:Gpr37 UTSW 6 25666946 unclassified probably benign
R2848:Gpr37 UTSW 6 25666946 unclassified probably benign
R4119:Gpr37 UTSW 6 25688426 missense possibly damaging 0.90
R4611:Gpr37 UTSW 6 25669624 missense probably benign 0.09
R4734:Gpr37 UTSW 6 25689086 missense possibly damaging 0.53
R4765:Gpr37 UTSW 6 25669108 missense probably damaging 1.00
R5163:Gpr37 UTSW 6 25669615 missense possibly damaging 0.87
R6548:Gpr37 UTSW 6 25688813 missense probably benign 0.32
R6760:Gpr37 UTSW 6 25669169 missense probably benign 0.00
R7030:Gpr37 UTSW 6 25689005 missense possibly damaging 0.92
R7278:Gpr37 UTSW 6 25669342 missense possibly damaging 0.68
R7392:Gpr37 UTSW 6 25688787 missense probably benign 0.34
R7726:Gpr37 UTSW 6 25669117 missense possibly damaging 0.94
R7754:Gpr37 UTSW 6 25689050 missense probably damaging 0.99
R7757:Gpr37 UTSW 6 25688208 missense probably benign 0.26
R8344:Gpr37 UTSW 6 25669531 missense probably damaging 1.00
R8734:Gpr37 UTSW 6 25688202 missense probably benign 0.17
R8839:Gpr37 UTSW 6 25669370 missense probably benign 0.15
V7732:Gpr37 UTSW 6 25669123 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCGTTGTCGTCACTGGTCAC -3'
(R):5'- CCTATGATGGTGCAAGGCTTTG -3'

Sequencing Primer
(F):5'- GTGGAAGACTTCTGGATACACTCC -3'
(R):5'- GGCTGCTACTTTTGTCTGCC -3'
Posted On 2016-11-09