Incidental Mutation 'R5669:Foxa3'
ID 442509
Institutional Source Beutler Lab
Gene Symbol Foxa3
Ensembl Gene ENSMUSG00000040891
Gene Name forkhead box A3
Synonyms Hnf-3g, Hnf3g, Tcf-3g, Tcf3g
MMRRC Submission 043312-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5669 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 19013284-19023538 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19014251 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 317 (T317A)
Ref Sequence ENSEMBL: ENSMUSP00000043173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036018]
AlphaFold P35584
Predicted Effect probably benign
Transcript: ENSMUST00000036018
AA Change: T317A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043173
Gene: ENSMUSG00000040891
AA Change: T317A

DomainStartEndE-ValueType
low complexity region 59 93 N/A INTRINSIC
FH 117 207 5.48e-62 SMART
low complexity region 226 267 N/A INTRINSIC
Pfam:HNF_C 304 332 1.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153321
AA Change: T316A
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific transcripts such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. The crystal structure of a similar protein in rat has been resolved. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced expression of several liver-specific and liver-enriched genes, but appear to be phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Akap9 T A 5: 4,050,540 L2734* probably null Het
Aldh1a1 T C 19: 20,610,920 I25T probably damaging Het
Astl G T 2: 127,347,279 R175L probably damaging Het
BC035947 A T 1: 78,497,913 C661S probably damaging Het
Cd160 C T 3: 96,808,898 probably benign Het
Cdc42bpb C T 12: 111,302,013 probably null Het
Cdip1 T A 16: 4,768,815 I149F probably damaging Het
Cfap65 T C 1: 74,924,968 Y607C probably damaging Het
Col6a5 A G 9: 105,925,998 I1256T unknown Het
Copb1 A G 7: 114,237,585 V336A probably damaging Het
Ddx42 A T 11: 106,241,819 D556V probably damaging Het
Dlk1 T C 12: 109,460,038 V279A probably benign Het
Fbll1 T C 11: 35,797,584 N284S probably benign Het
Fbxw21 A T 9: 109,145,510 I314N probably benign Het
Gm14139 A G 2: 150,192,178 I140V probably benign Het
Gpr37 A T 6: 25,669,352 C498S probably benign Het
Hapln3 G T 7: 79,117,496 probably null Het
Igkv4-54 A G 6: 69,631,848 V29A possibly damaging Het
Itgb8 T A 12: 119,190,628 I225F probably damaging Het
Kcnk3 A G 5: 30,622,349 T248A probably damaging Het
Kcnv1 T C 15: 45,114,252 Q130R possibly damaging Het
Lrp1b T C 2: 41,111,038 H2058R probably damaging Het
Macf1 T A 4: 123,476,225 E1581V probably damaging Het
Mga A G 2: 119,903,426 N252D probably damaging Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Olfr1115 T C 2: 87,252,441 V168A probably benign Het
Olfr58 T C 9: 19,783,757 F208S probably benign Het
Pak7 G A 2: 136,116,284 P295S probably damaging Het
Pcsk1 T A 13: 75,130,102 S595T probably benign Het
Pepd T C 7: 35,040,674 V324A probably benign Het
Pml C T 9: 58,247,063 D176N probably benign Het
Popdc3 T A 10: 45,316,433 I163N probably damaging Het
Ppp1r13l A C 7: 19,373,022 T481P probably benign Het
Pramef12 T C 4: 144,395,843 I44V probably benign Het
Prlh A G 1: 90,953,120 T5A probably benign Het
Prom1 A G 5: 44,012,943 F638S possibly damaging Het
Prpf8 T A 11: 75,504,738 L1897H probably damaging Het
Ret T C 6: 118,184,243 T91A probably benign Het
Retsat A G 6: 72,606,010 S176G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,458,785 L3823P possibly damaging Het
Rnf31 C T 14: 55,596,704 A653V probably damaging Het
Rps6kl1 T C 12: 85,147,867 D90G probably damaging Het
Scarb1 A G 5: 125,300,387 Y194H probably damaging Het
Scube2 C T 7: 109,825,439 A556T probably benign Het
Serpinb1a A G 13: 32,845,316 L243P probably damaging Het
Slc39a4 A C 15: 76,614,163 L358R probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Srgap1 C A 10: 121,804,850 V681L probably benign Het
Tmprss6 A T 15: 78,454,956 M262K possibly damaging Het
Ttf2 T A 3: 100,951,117 K719* probably null Het
Vmn1r62 T A 7: 5,675,737 L139* probably null Het
Other mutations in Foxa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Foxa3 APN 7 19014518 missense probably benign
R0378:Foxa3 UTSW 7 19023369 missense probably damaging 1.00
R1833:Foxa3 UTSW 7 19014574 missense probably damaging 1.00
R2159:Foxa3 UTSW 7 19014184 missense probably benign 0.40
R2877:Foxa3 UTSW 7 19014880 missense probably benign 0.38
R4666:Foxa3 UTSW 7 19014372 nonsense probably null
R5533:Foxa3 UTSW 7 19015015 nonsense probably null
R7339:Foxa3 UTSW 7 19014869 missense probably damaging 1.00
R8128:Foxa3 UTSW 7 19023416 start codon destroyed probably null 0.77
R8329:Foxa3 UTSW 7 19014184 missense probably benign 0.40
R9232:Foxa3 UTSW 7 19014865 missense probably damaging 1.00
R9305:Foxa3 UTSW 7 19015036 missense possibly damaging 0.82
R9627:Foxa3 UTSW 7 19014533 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGCCCAAGAACGTTGCAG -3'
(R):5'- TTGAGAACGGCTGCTATCTCC -3'

Sequencing Primer
(F):5'- AGAACGTTGCAGCCCACG -3'
(R):5'- GCAGAAGCGCTTCAAGCTG -3'
Posted On 2016-11-09