Incidental Mutation 'R5669:Hapln3'
ID 442512
Institutional Source Beutler Lab
Gene Symbol Hapln3
Ensembl Gene ENSMUSG00000030606
Gene Name hyaluronan and proteoglycan link protein 3
Synonyms Lpr3, 4930554N11Rik
MMRRC Submission 043312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R5669 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 79115102-79131018 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 79117496 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032827] [ENSMUST00000032835] [ENSMUST00000205782] [ENSMUST00000206092]
AlphaFold Q80WM5
Predicted Effect probably benign
Transcript: ENSMUST00000032827
SMART Domains Protein: ENSMUSP00000032827
Gene: ENSMUSG00000030606

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IGv 65 148 3.28e-8 SMART
LINK 164 261 1.78e-46 SMART
LINK 265 357 3.14e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032835
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205782
Predicted Effect probably null
Transcript: ENSMUST00000206092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206402
Predicted Effect probably benign
Transcript: ENSMUST00000206779
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the hyaluronan and proteoglycan binding link protein gene family. The protein encoded by this gene may function in hyaluronic acid binding and cell adhesion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Akap9 T A 5: 4,050,540 L2734* probably null Het
Aldh1a1 T C 19: 20,610,920 I25T probably damaging Het
Astl G T 2: 127,347,279 R175L probably damaging Het
BC035947 A T 1: 78,497,913 C661S probably damaging Het
Cd160 C T 3: 96,808,898 probably benign Het
Cdc42bpb C T 12: 111,302,013 probably null Het
Cdip1 T A 16: 4,768,815 I149F probably damaging Het
Cfap65 T C 1: 74,924,968 Y607C probably damaging Het
Col6a5 A G 9: 105,925,998 I1256T unknown Het
Copb1 A G 7: 114,237,585 V336A probably damaging Het
Ddx42 A T 11: 106,241,819 D556V probably damaging Het
Dlk1 T C 12: 109,460,038 V279A probably benign Het
Fbll1 T C 11: 35,797,584 N284S probably benign Het
Fbxw21 A T 9: 109,145,510 I314N probably benign Het
Foxa3 T C 7: 19,014,251 T317A probably benign Het
Gm14139 A G 2: 150,192,178 I140V probably benign Het
Gpr37 A T 6: 25,669,352 C498S probably benign Het
Igkv4-54 A G 6: 69,631,848 V29A possibly damaging Het
Itgb8 T A 12: 119,190,628 I225F probably damaging Het
Kcnk3 A G 5: 30,622,349 T248A probably damaging Het
Kcnv1 T C 15: 45,114,252 Q130R possibly damaging Het
Lrp1b T C 2: 41,111,038 H2058R probably damaging Het
Macf1 T A 4: 123,476,225 E1581V probably damaging Het
Mga A G 2: 119,903,426 N252D probably damaging Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Olfr1115 T C 2: 87,252,441 V168A probably benign Het
Olfr58 T C 9: 19,783,757 F208S probably benign Het
Pak7 G A 2: 136,116,284 P295S probably damaging Het
Pcsk1 T A 13: 75,130,102 S595T probably benign Het
Pepd T C 7: 35,040,674 V324A probably benign Het
Pml C T 9: 58,247,063 D176N probably benign Het
Popdc3 T A 10: 45,316,433 I163N probably damaging Het
Ppp1r13l A C 7: 19,373,022 T481P probably benign Het
Pramef12 T C 4: 144,395,843 I44V probably benign Het
Prlh A G 1: 90,953,120 T5A probably benign Het
Prom1 A G 5: 44,012,943 F638S possibly damaging Het
Prpf8 T A 11: 75,504,738 L1897H probably damaging Het
Ret T C 6: 118,184,243 T91A probably benign Het
Retsat A G 6: 72,606,010 S176G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,458,785 L3823P possibly damaging Het
Rnf31 C T 14: 55,596,704 A653V probably damaging Het
Rps6kl1 T C 12: 85,147,867 D90G probably damaging Het
Scarb1 A G 5: 125,300,387 Y194H probably damaging Het
Scube2 C T 7: 109,825,439 A556T probably benign Het
Serpinb1a A G 13: 32,845,316 L243P probably damaging Het
Slc39a4 A C 15: 76,614,163 L358R probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Srgap1 C A 10: 121,804,850 V681L probably benign Het
Tmprss6 A T 15: 78,454,956 M262K possibly damaging Het
Ttf2 T A 3: 100,951,117 K719* probably null Het
Vmn1r62 T A 7: 5,675,737 L139* probably null Het
Other mutations in Hapln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Hapln3 APN 7 79121983 missense probably damaging 1.00
IGL01412:Hapln3 APN 7 79117436 splice site probably null
IGL02141:Hapln3 APN 7 79118145 missense probably damaging 0.99
IGL02675:Hapln3 APN 7 79117848 critical splice donor site probably null
IGL02864:Hapln3 APN 7 79118064 missense probably benign 0.03
IGL02894:Hapln3 APN 7 79121773 missense probably benign 0.03
R1271:Hapln3 UTSW 7 79118016 missense probably damaging 1.00
R1337:Hapln3 UTSW 7 79118076 missense probably benign 0.06
R1351:Hapln3 UTSW 7 79121960 missense probably damaging 1.00
R1686:Hapln3 UTSW 7 79121890 missense probably benign 0.13
R1718:Hapln3 UTSW 7 79123450 missense unknown
R3103:Hapln3 UTSW 7 79121736 missense probably benign 0.07
R5625:Hapln3 UTSW 7 79117258 splice site probably null
R5862:Hapln3 UTSW 7 79121891 missense possibly damaging 0.84
R5875:Hapln3 UTSW 7 79121973 missense probably benign 0.03
R7129:Hapln3 UTSW 7 79121824 missense probably damaging 1.00
R7439:Hapln3 UTSW 7 79117269 missense probably benign 0.00
R7713:Hapln3 UTSW 7 79117373 missense probably benign 0.00
R8894:Hapln3 UTSW 7 79117491 missense probably benign 0.00
R8896:Hapln3 UTSW 7 79117491 missense probably benign 0.00
R8933:Hapln3 UTSW 7 79117630 unclassified probably benign
R9114:Hapln3 UTSW 7 79121964 missense probably benign 0.00
R9367:Hapln3 UTSW 7 79121707 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTTGAGTCGAGGGTGAACTATAG -3'
(R):5'- TGGGTGCTCACTCAGAATGC -3'

Sequencing Primer
(F):5'- ACTATAGGGTAGCGGGCACTTC -3'
(R):5'- GGTGCTCACTCAGAATGCAATTG -3'
Posted On 2016-11-09