Incidental Mutation 'R5669:Copb1'
ID442514
Institutional Source Beutler Lab
Gene Symbol Copb1
Ensembl Gene ENSMUSG00000030754
Gene Namecoatomer protein complex, subunit beta 1
SynonymsCopb1, 2610019B04Rik
MMRRC Submission 043312-MU
Accession Numbers

Genbank: NM_033370; MGI: 1917599

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5669 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location114215559-114254711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114237585 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 336 (V336A)
Ref Sequence ENSEMBL: ENSMUSP00000033012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033012]
Predicted Effect probably damaging
Transcript: ENSMUST00000033012
AA Change: V336A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033012
Gene: ENSMUSG00000030754
AA Change: V336A

DomainStartEndE-ValueType
Pfam:Adaptin_N 19 539 2.4e-124 PFAM
low complexity region 643 660 N/A INTRINSIC
Pfam:Coatamer_beta_C 667 807 3.6e-63 PFAM
Pfam:Coatomer_b_Cpla 813 944 3.1e-65 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein subunit of the coatomer complex associated with non-clathrin coated vesicles. The coatomer complex, also known as the coat protein complex 1, forms in the cytoplasm and is recruited to the Golgi by activated guanosine triphosphatases. Once at the Golgi membrane, the coatomer complex may assist in the movement of protein and lipid components back to the endoplasmic reticulum. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Akap9 T A 5: 4,050,540 L2734* probably null Het
Aldh1a1 T C 19: 20,610,920 I25T probably damaging Het
Astl G T 2: 127,347,279 R175L probably damaging Het
BC035947 A T 1: 78,497,913 C661S probably damaging Het
Cd160 C T 3: 96,808,898 probably benign Het
Cdc42bpb C T 12: 111,302,013 probably null Het
Cdip1 T A 16: 4,768,815 I149F probably damaging Het
Cfap65 T C 1: 74,924,968 Y607C probably damaging Het
Col6a5 A G 9: 105,925,998 I1256T unknown Het
Ddx42 A T 11: 106,241,819 D556V probably damaging Het
Dlk1 T C 12: 109,460,038 V279A probably benign Het
Fbll1 T C 11: 35,797,584 N284S probably benign Het
Fbxw21 A T 9: 109,145,510 I314N probably benign Het
Foxa3 T C 7: 19,014,251 T317A probably benign Het
Gm14139 A G 2: 150,192,178 I140V probably benign Het
Gpr37 A T 6: 25,669,352 C498S probably benign Het
Hapln3 G T 7: 79,117,496 probably null Het
Igkv4-54 A G 6: 69,631,848 V29A possibly damaging Het
Itgb8 T A 12: 119,190,628 I225F probably damaging Het
Kcnk3 A G 5: 30,622,349 T248A probably damaging Het
Kcnv1 T C 15: 45,114,252 Q130R possibly damaging Het
Lrp1b T C 2: 41,111,038 H2058R probably damaging Het
Macf1 T A 4: 123,476,225 E1581V probably damaging Het
Mga A G 2: 119,903,426 N252D probably damaging Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Olfr1115 T C 2: 87,252,441 V168A probably benign Het
Olfr58 T C 9: 19,783,757 F208S probably benign Het
Pak7 G A 2: 136,116,284 P295S probably damaging Het
Pcsk1 T A 13: 75,130,102 S595T probably benign Het
Pepd T C 7: 35,040,674 V324A probably benign Het
Pml C T 9: 58,247,063 D176N probably benign Het
Popdc3 T A 10: 45,316,433 I163N probably damaging Het
Ppp1r13l A C 7: 19,373,022 T481P probably benign Het
Pramef12 T C 4: 144,395,843 I44V probably benign Het
Prlh A G 1: 90,953,120 T5A probably benign Het
Prom1 A G 5: 44,012,943 F638S possibly damaging Het
Prpf8 T A 11: 75,504,738 L1897H probably damaging Het
Ret T C 6: 118,184,243 T91A probably benign Het
Retsat A G 6: 72,606,010 S176G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,458,785 L3823P possibly damaging Het
Rnf31 C T 14: 55,596,704 A653V probably damaging Het
Rps6kl1 T C 12: 85,147,867 D90G probably damaging Het
Scarb1 A G 5: 125,300,387 Y194H probably damaging Het
Scube2 C T 7: 109,825,439 A556T probably benign Het
Serpinb1a A G 13: 32,845,316 L243P probably damaging Het
Slc39a4 A C 15: 76,614,163 L358R probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Srgap1 C A 10: 121,804,850 V681L probably benign Het
Tmprss6 A T 15: 78,454,956 M262K possibly damaging Het
Ttf2 T A 3: 100,951,117 K719* probably null Het
Vmn1r62 T A 7: 5,675,737 L139* probably null Het
Other mutations in Copb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Copb1 APN 7 114226776 missense probably benign 0.00
IGL02458:Copb1 APN 7 114246785 missense probably benign 0.00
IGL02549:Copb1 APN 7 114246797 missense probably benign 0.00
IGL02639:Copb1 APN 7 114226595 splice site probably benign
robbers UTSW 7 114248976 missense probably damaging 1.00
R0012:Copb1 UTSW 7 114237408 missense probably damaging 0.99
R0012:Copb1 UTSW 7 114237408 missense probably damaging 0.99
R0023:Copb1 UTSW 7 114250094 missense probably benign 0.26
R0631:Copb1 UTSW 7 114233282 missense probably benign 0.12
R1996:Copb1 UTSW 7 114232203 missense probably benign 0.00
R2256:Copb1 UTSW 7 114253875 missense possibly damaging 0.89
R2257:Copb1 UTSW 7 114253875 missense possibly damaging 0.89
R3853:Copb1 UTSW 7 114223316 missense probably damaging 1.00
R4679:Copb1 UTSW 7 114248976 missense probably damaging 1.00
R4686:Copb1 UTSW 7 114221736 missense possibly damaging 0.94
R5057:Copb1 UTSW 7 114226762 missense probably benign
R5140:Copb1 UTSW 7 114246800 missense probably benign 0.01
R5779:Copb1 UTSW 7 114219572 missense probably damaging 1.00
R6017:Copb1 UTSW 7 114236797 missense probably benign 0.07
R6114:Copb1 UTSW 7 114246801 missense probably benign 0.00
R6403:Copb1 UTSW 7 114238451 missense probably damaging 1.00
R6826:Copb1 UTSW 7 114226719 missense probably benign 0.00
R6905:Copb1 UTSW 7 114253890 missense probably benign 0.00
R7241:Copb1 UTSW 7 114237356 missense probably damaging 0.96
R7293:Copb1 UTSW 7 114219602 missense probably damaging 1.00
R7485:Copb1 UTSW 7 114245485 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTCAGTGTCTTCATGCTCAGAC -3'
(R):5'- TACTAGCGACCCCGAGTATC -3'

Sequencing Primer
(F):5'- GTCTTCATGCTCAGACACATTATTTG -3'
(R):5'- GCGACCCCGAGTATCTGCTTC -3'
Posted On2016-11-09