Incidental Mutation 'R5669:Pml'
ID442517
Institutional Source Beutler Lab
Gene Symbol Pml
Ensembl Gene ENSMUSG00000036986
Gene Namepromyelocytic leukemia
SynonymsTrim19, 1200009E24Rik
MMRRC Submission 043312-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5669 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location58218076-58249786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58247063 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 176 (D176N)
Ref Sequence ENSEMBL: ENSMUSP00000118955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085673] [ENSMUST00000114136] [ENSMUST00000124063] [ENSMUST00000124982] [ENSMUST00000135310] [ENSMUST00000148301] [ENSMUST00000153820]
Predicted Effect probably benign
Transcript: ENSMUST00000085673
AA Change: D176N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082816
Gene: ENSMUSG00000036986
AA Change: D176N

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 5e-7 BLAST
Pfam:DUF3583 244 580 4e-166 PFAM
Blast:EXOIII 619 762 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114136
AA Change: D176N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109771
Gene: ENSMUSG00000036986
AA Change: D176N

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 4e-7 BLAST
Pfam:DUF3583 244 434 5.5e-109 PFAM
Pfam:DUF3583 428 535 1.4e-57 PFAM
Blast:EXOIII 573 716 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124063
SMART Domains Protein: ENSMUSP00000118232
Gene: ENSMUSG00000036986

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124982
SMART Domains Protein: ENSMUSP00000121380
Gene: ENSMUSG00000036986

DomainStartEndE-ValueType
RING 22 56 1.83e-3 SMART
Pfam:zf-B_box 89 119 4.3e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000126690
AA Change: D167N
SMART Domains Protein: ENSMUSP00000116787
Gene: ENSMUSG00000036986
AA Change: D167N

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
RING 54 88 1.83e-3 SMART
BBOX 121 163 4.99e-5 SMART
Blast:BBOX 181 225 4e-7 BLAST
Pfam:DUF3583 236 422 1.4e-89 PFAM
Pfam:DUF3583 411 526 2.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130459
SMART Domains Protein: ENSMUSP00000121330
Gene: ENSMUSG00000036986

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135310
AA Change: D176N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122854
Gene: ENSMUSG00000036986
AA Change: D176N

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 4e-7 BLAST
Pfam:DUF3583 244 581 8.8e-193 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148301
SMART Domains Protein: ENSMUSP00000120620
Gene: ENSMUSG00000036986

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153820
AA Change: D176N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118955
Gene: ENSMUSG00000036986
AA Change: D176N

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 4e-7 BLAST
Pfam:DUF3583 244 581 9.2e-193 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene have an increased susceptibility to infection and to induction of tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Akap9 T A 5: 4,050,540 L2734* probably null Het
Aldh1a1 T C 19: 20,610,920 I25T probably damaging Het
Astl G T 2: 127,347,279 R175L probably damaging Het
BC035947 A T 1: 78,497,913 C661S probably damaging Het
Cd160 C T 3: 96,808,898 probably benign Het
Cdc42bpb C T 12: 111,302,013 probably null Het
Cdip1 T A 16: 4,768,815 I149F probably damaging Het
Cfap65 T C 1: 74,924,968 Y607C probably damaging Het
Col6a5 A G 9: 105,925,998 I1256T unknown Het
Copb1 A G 7: 114,237,585 V336A probably damaging Het
Ddx42 A T 11: 106,241,819 D556V probably damaging Het
Dlk1 T C 12: 109,460,038 V279A probably benign Het
Fbll1 T C 11: 35,797,584 N284S probably benign Het
Fbxw21 A T 9: 109,145,510 I314N probably benign Het
Foxa3 T C 7: 19,014,251 T317A probably benign Het
Gm14139 A G 2: 150,192,178 I140V probably benign Het
Gpr37 A T 6: 25,669,352 C498S probably benign Het
Hapln3 G T 7: 79,117,496 probably null Het
Igkv4-54 A G 6: 69,631,848 V29A possibly damaging Het
Itgb8 T A 12: 119,190,628 I225F probably damaging Het
Kcnk3 A G 5: 30,622,349 T248A probably damaging Het
Kcnv1 T C 15: 45,114,252 Q130R possibly damaging Het
Lrp1b T C 2: 41,111,038 H2058R probably damaging Het
Macf1 T A 4: 123,476,225 E1581V probably damaging Het
Mga A G 2: 119,903,426 N252D probably damaging Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Olfr1115 T C 2: 87,252,441 V168A probably benign Het
Olfr58 T C 9: 19,783,757 F208S probably benign Het
Pak7 G A 2: 136,116,284 P295S probably damaging Het
Pcsk1 T A 13: 75,130,102 S595T probably benign Het
Pepd T C 7: 35,040,674 V324A probably benign Het
Popdc3 T A 10: 45,316,433 I163N probably damaging Het
Ppp1r13l A C 7: 19,373,022 T481P probably benign Het
Pramef12 T C 4: 144,395,843 I44V probably benign Het
Prlh A G 1: 90,953,120 T5A probably benign Het
Prom1 A G 5: 44,012,943 F638S possibly damaging Het
Prpf8 T A 11: 75,504,738 L1897H probably damaging Het
Ret T C 6: 118,184,243 T91A probably benign Het
Retsat A G 6: 72,606,010 S176G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,458,785 L3823P possibly damaging Het
Rnf31 C T 14: 55,596,704 A653V probably damaging Het
Rps6kl1 T C 12: 85,147,867 D90G probably damaging Het
Scarb1 A G 5: 125,300,387 Y194H probably damaging Het
Scube2 C T 7: 109,825,439 A556T probably benign Het
Serpinb1a A G 13: 32,845,316 L243P probably damaging Het
Slc39a4 A C 15: 76,614,163 L358R probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Srgap1 C A 10: 121,804,850 V681L probably benign Het
Tmprss6 A T 15: 78,454,956 M262K possibly damaging Het
Ttf2 T A 3: 100,951,117 K719* probably null Het
Vmn1r62 T A 7: 5,675,737 L139* probably null Het
Other mutations in Pml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Pml APN 9 58247003 missense probably benign 0.04
IGL03147:Pml UTSW 9 58230043 missense possibly damaging 0.85
R0019:Pml UTSW 9 58220493 missense probably damaging 1.00
R0905:Pml UTSW 9 58249539 critical splice donor site probably null
R1171:Pml UTSW 9 58234538 missense probably damaging 1.00
R2189:Pml UTSW 9 58234874 missense probably benign 0.00
R2330:Pml UTSW 9 58234571 missense probably damaging 1.00
R2909:Pml UTSW 9 58247243 missense possibly damaging 0.75
R4749:Pml UTSW 9 58234652 missense probably damaging 0.99
R5228:Pml UTSW 9 58219997 missense probably damaging 1.00
R5300:Pml UTSW 9 58247019 missense probably damaging 1.00
R5876:Pml UTSW 9 58233182 missense possibly damaging 0.71
R6854:Pml UTSW 9 58219906 missense probably damaging 0.99
R6996:Pml UTSW 9 58234886 missense probably damaging 1.00
R7387:Pml UTSW 9 58229894 missense probably benign 0.08
R7448:Pml UTSW 9 58247213 missense probably benign 0.27
R7762:Pml UTSW 9 58220173 missense probably damaging 1.00
R7833:Pml UTSW 9 58234685 missense probably benign 0.15
R7834:Pml UTSW 9 58234685 missense probably benign 0.15
R7903:Pml UTSW 9 58249584 missense probably benign 0.01
R7916:Pml UTSW 9 58234685 missense probably benign 0.15
R7917:Pml UTSW 9 58234685 missense probably benign 0.15
R7986:Pml UTSW 9 58249584 missense probably benign 0.01
R8040:Pml UTSW 9 58234685 missense probably benign 0.15
R8041:Pml UTSW 9 58234685 missense probably benign 0.15
R8042:Pml UTSW 9 58234685 missense probably benign 0.15
R8046:Pml UTSW 9 58246973 critical splice donor site probably null
Z1088:Pml UTSW 9 58234590 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGCAAAGATGACTCTGAAGC -3'
(R):5'- AACGTGTTCTTCGAGAGCCTG -3'

Sequencing Primer
(F):5'- GGGTCATTAGAAACGACTATAAACC -3'
(R):5'- CGACTTCTGGTGTTTCGA -3'
Posted On2016-11-09