Incidental Mutation 'R5669:Dlk1'
ID442530
Institutional Source Beutler Lab
Gene Symbol Dlk1
Ensembl Gene ENSMUSG00000040856
Gene Namedelta like non-canonical Notch ligand 1
SynonymspG2, SCP1, ZOG, FA1, Peg9, pref-1, DlkI
MMRRC Submission 043312-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.801) question?
Stock #R5669 (G1)
Quality Score126
Status Not validated
Chromosome12
Chromosomal Location109452823-109463336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109460038 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 279 (V279A)
Ref Sequence ENSEMBL: ENSMUSP00000105470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056110] [ENSMUST00000109841] [ENSMUST00000109842] [ENSMUST00000109843] [ENSMUST00000109844] [ENSMUST00000109846] [ENSMUST00000124293] [ENSMUST00000173539]
Predicted Effect probably benign
Transcript: ENSMUST00000056110
AA Change: V279A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000063104
Gene: ENSMUSG00000040856
AA Change: V279A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
EGF 213 247 4.06e-6 SMART
transmembrane domain 307 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109841
SMART Domains Protein: ENSMUSP00000105467
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109842
SMART Domains Protein: ENSMUSP00000105468
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 234 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109843
SMART Domains Protein: ENSMUSP00000105469
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 212 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109844
AA Change: V279A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105470
Gene: ENSMUSG00000040856
AA Change: V279A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
EGF 213 247 4.06e-6 SMART
transmembrane domain 307 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109846
SMART Domains Protein: ENSMUSP00000105472
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 256 278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124293
SMART Domains Protein: ENSMUSP00000133530
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
EGF 24 54 1.43e-1 SMART
EGF 55 85 1.26e-2 SMART
EGF_CA 87 124 1.77e-6 SMART
EGF 129 167 8.71e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173539
SMART Domains Protein: ENSMUSP00000133430
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 232 254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173812
SMART Domains Protein: ENSMUSP00000134308
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
SCOP:d1eqga2 2 15 4e-3 SMART
transmembrane domain 44 66 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that contains multiple epidermal growth factor repeats that functions as a regulator of cell growth. The encoded protein is involved in the differentiation of several cell types including adipocytes. This gene is located in a region of chromosome 14 frequently showing unparental disomy, and is imprinted and expressed from the paternal allele. A single nucleotide variant in this gene is associated with child and adolescent obesity and shows polar overdominance, where heterozygotes carrying an active paternal allele express the phenotype, while mutant homozygotes are normal. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygote null mice have reduced fetal growth and 50% lethality 2 days after birth. Survivors are small but have enlarged fat pad masses. Homozygotes for another null allele have abnormal B cell development. Paternally-inherited null alleles phenocopy homozygotes due to maternal imprinting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Akap9 T A 5: 4,050,540 L2734* probably null Het
Aldh1a1 T C 19: 20,610,920 I25T probably damaging Het
Astl G T 2: 127,347,279 R175L probably damaging Het
BC035947 A T 1: 78,497,913 C661S probably damaging Het
Cd160 C T 3: 96,808,898 probably benign Het
Cdc42bpb C T 12: 111,302,013 probably null Het
Cdip1 T A 16: 4,768,815 I149F probably damaging Het
Cfap65 T C 1: 74,924,968 Y607C probably damaging Het
Col6a5 A G 9: 105,925,998 I1256T unknown Het
Copb1 A G 7: 114,237,585 V336A probably damaging Het
Ddx42 A T 11: 106,241,819 D556V probably damaging Het
Fbll1 T C 11: 35,797,584 N284S probably benign Het
Fbxw21 A T 9: 109,145,510 I314N probably benign Het
Foxa3 T C 7: 19,014,251 T317A probably benign Het
Gm14139 A G 2: 150,192,178 I140V probably benign Het
Gpr37 A T 6: 25,669,352 C498S probably benign Het
Hapln3 G T 7: 79,117,496 probably null Het
Igkv4-54 A G 6: 69,631,848 V29A possibly damaging Het
Itgb8 T A 12: 119,190,628 I225F probably damaging Het
Kcnk3 A G 5: 30,622,349 T248A probably damaging Het
Kcnv1 T C 15: 45,114,252 Q130R possibly damaging Het
Lrp1b T C 2: 41,111,038 H2058R probably damaging Het
Macf1 T A 4: 123,476,225 E1581V probably damaging Het
Mga A G 2: 119,903,426 N252D probably damaging Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Olfr1115 T C 2: 87,252,441 V168A probably benign Het
Olfr58 T C 9: 19,783,757 F208S probably benign Het
Pak7 G A 2: 136,116,284 P295S probably damaging Het
Pcsk1 T A 13: 75,130,102 S595T probably benign Het
Pepd T C 7: 35,040,674 V324A probably benign Het
Pml C T 9: 58,247,063 D176N probably benign Het
Popdc3 T A 10: 45,316,433 I163N probably damaging Het
Ppp1r13l A C 7: 19,373,022 T481P probably benign Het
Pramef12 T C 4: 144,395,843 I44V probably benign Het
Prlh A G 1: 90,953,120 T5A probably benign Het
Prom1 A G 5: 44,012,943 F638S possibly damaging Het
Prpf8 T A 11: 75,504,738 L1897H probably damaging Het
Ret T C 6: 118,184,243 T91A probably benign Het
Retsat A G 6: 72,606,010 S176G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,458,785 L3823P possibly damaging Het
Rnf31 C T 14: 55,596,704 A653V probably damaging Het
Rps6kl1 T C 12: 85,147,867 D90G probably damaging Het
Scarb1 A G 5: 125,300,387 Y194H probably damaging Het
Scube2 C T 7: 109,825,439 A556T probably benign Het
Serpinb1a A G 13: 32,845,316 L243P probably damaging Het
Slc39a4 A C 15: 76,614,163 L358R probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Srgap1 C A 10: 121,804,850 V681L probably benign Het
Tmprss6 A T 15: 78,454,956 M262K possibly damaging Het
Ttf2 T A 3: 100,951,117 K719* probably null Het
Vmn1r62 T A 7: 5,675,737 L139* probably null Het
Other mutations in Dlk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0041:Dlk1 UTSW 12 109455513 missense probably damaging 1.00
R0379:Dlk1 UTSW 12 109455059 unclassified probably benign
R1250:Dlk1 UTSW 12 109459818 missense probably damaging 1.00
R1363:Dlk1 UTSW 12 109455504 missense probably damaging 1.00
R1757:Dlk1 UTSW 12 109459687 missense probably damaging 1.00
R1763:Dlk1 UTSW 12 109458119 missense probably damaging 1.00
R1772:Dlk1 UTSW 12 109459759 missense probably damaging 1.00
R2189:Dlk1 UTSW 12 109455049 critical splice donor site probably null
R2334:Dlk1 UTSW 12 109453688 missense probably damaging 0.96
R3751:Dlk1 UTSW 12 109460313 missense probably benign 0.15
R5256:Dlk1 UTSW 12 109459771 missense probably damaging 1.00
R5268:Dlk1 UTSW 12 109459838 missense probably benign 0.34
R5356:Dlk1 UTSW 12 109455521 missense probably damaging 0.99
R5748:Dlk1 UTSW 12 109459972 missense probably benign 0.00
R5992:Dlk1 UTSW 12 109455581 missense probably damaging 1.00
R6076:Dlk1 UTSW 12 109459969 missense probably damaging 0.98
R6539:Dlk1 UTSW 12 109460319 missense probably benign 0.01
R6638:Dlk1 UTSW 12 109460278 missense probably damaging 1.00
R7480:Dlk1 UTSW 12 109455614 missense probably damaging 1.00
R7553:Dlk1 UTSW 12 109454963 missense unknown
R7602:Dlk1 UTSW 12 109455625 critical splice donor site probably null
X0020:Dlk1 UTSW 12 109459912 missense probably damaging 1.00
X0053:Dlk1 UTSW 12 109460137 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTCGTCGACAAGACCTGCAG -3'
(R):5'- CCAGGTTTCGCACTTGTTGAG -3'

Sequencing Primer
(F):5'- TGAGCAACTGCGCCAGTG -3'
(R):5'- TTCGCACTTGTTGAGAAAGACG -3'
Posted On2016-11-09