Incidental Mutation 'R5669:Kcnv1'
ID442537
Institutional Source Beutler Lab
Gene Symbol Kcnv1
Ensembl Gene ENSMUSG00000022342
Gene Namepotassium channel, subfamily V, member 1
Synonyms2700023A03Rik
MMRRC Submission 043312-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5669 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location45106284-45114920 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45114252 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 130 (Q130R)
Ref Sequence ENSEMBL: ENSMUSP00000022967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022967]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022967
AA Change: Q130R

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022967
Gene: ENSMUSG00000022342
AA Change: Q130R

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
BTB 42 160 1.17e-12 SMART
Pfam:Ion_trans 212 440 8.9e-45 PFAM
Pfam:Ion_trans_2 350 436 3.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228536
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium voltage-gated channel subfamily V. This protein is essentially present in the brain, and its role might be to inhibit the function of a particular class of outward rectifier potassium channel types. [provided by RefSeq, Jul 2008]
PHENOTYPE: At weaning, homozygous mutant mice exhibit tetany, tremors and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Akap9 T A 5: 4,050,540 L2734* probably null Het
Aldh1a1 T C 19: 20,610,920 I25T probably damaging Het
Astl G T 2: 127,347,279 R175L probably damaging Het
BC035947 A T 1: 78,497,913 C661S probably damaging Het
Cd160 C T 3: 96,808,898 probably benign Het
Cdc42bpb C T 12: 111,302,013 probably null Het
Cdip1 T A 16: 4,768,815 I149F probably damaging Het
Cfap65 T C 1: 74,924,968 Y607C probably damaging Het
Col6a5 A G 9: 105,925,998 I1256T unknown Het
Copb1 A G 7: 114,237,585 V336A probably damaging Het
Ddx42 A T 11: 106,241,819 D556V probably damaging Het
Dlk1 T C 12: 109,460,038 V279A probably benign Het
Fbll1 T C 11: 35,797,584 N284S probably benign Het
Fbxw21 A T 9: 109,145,510 I314N probably benign Het
Foxa3 T C 7: 19,014,251 T317A probably benign Het
Gm14139 A G 2: 150,192,178 I140V probably benign Het
Gpr37 A T 6: 25,669,352 C498S probably benign Het
Hapln3 G T 7: 79,117,496 probably null Het
Igkv4-54 A G 6: 69,631,848 V29A possibly damaging Het
Itgb8 T A 12: 119,190,628 I225F probably damaging Het
Kcnk3 A G 5: 30,622,349 T248A probably damaging Het
Lrp1b T C 2: 41,111,038 H2058R probably damaging Het
Macf1 T A 4: 123,476,225 E1581V probably damaging Het
Mga A G 2: 119,903,426 N252D probably damaging Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Olfr1115 T C 2: 87,252,441 V168A probably benign Het
Olfr58 T C 9: 19,783,757 F208S probably benign Het
Pak7 G A 2: 136,116,284 P295S probably damaging Het
Pcsk1 T A 13: 75,130,102 S595T probably benign Het
Pepd T C 7: 35,040,674 V324A probably benign Het
Pml C T 9: 58,247,063 D176N probably benign Het
Popdc3 T A 10: 45,316,433 I163N probably damaging Het
Ppp1r13l A C 7: 19,373,022 T481P probably benign Het
Pramef12 T C 4: 144,395,843 I44V probably benign Het
Prlh A G 1: 90,953,120 T5A probably benign Het
Prom1 A G 5: 44,012,943 F638S possibly damaging Het
Prpf8 T A 11: 75,504,738 L1897H probably damaging Het
Ret T C 6: 118,184,243 T91A probably benign Het
Retsat A G 6: 72,606,010 S176G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,458,785 L3823P possibly damaging Het
Rnf31 C T 14: 55,596,704 A653V probably damaging Het
Rps6kl1 T C 12: 85,147,867 D90G probably damaging Het
Scarb1 A G 5: 125,300,387 Y194H probably damaging Het
Scube2 C T 7: 109,825,439 A556T probably benign Het
Serpinb1a A G 13: 32,845,316 L243P probably damaging Het
Slc39a4 A C 15: 76,614,163 L358R probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Srgap1 C A 10: 121,804,850 V681L probably benign Het
Tmprss6 A T 15: 78,454,956 M262K possibly damaging Het
Ttf2 T A 3: 100,951,117 K719* probably null Het
Vmn1r62 T A 7: 5,675,737 L139* probably null Het
Other mutations in Kcnv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Kcnv1 APN 15 45113228 missense probably benign 0.00
IGL02227:Kcnv1 APN 15 45114274 missense probably damaging 1.00
IGL02472:Kcnv1 APN 15 45109123 nonsense probably null
IGL03239:Kcnv1 APN 15 45109490 splice site probably benign
R0079:Kcnv1 UTSW 15 45113333 missense probably damaging 1.00
R0534:Kcnv1 UTSW 15 45109249 missense probably damaging 0.98
R0627:Kcnv1 UTSW 15 45112881 splice site probably benign
R1614:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R1615:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R2942:Kcnv1 UTSW 15 45109185 missense probably damaging 1.00
R4244:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4290:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4291:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4293:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4294:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4295:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4335:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4342:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4345:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4354:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4934:Kcnv1 UTSW 15 45109248 missense probably damaging 1.00
R5240:Kcnv1 UTSW 15 45113244 missense probably damaging 1.00
R5295:Kcnv1 UTSW 15 45114591 missense unknown
R5631:Kcnv1 UTSW 15 45109357 missense probably damaging 1.00
R5762:Kcnv1 UTSW 15 45109122 missense probably damaging 0.99
R5776:Kcnv1 UTSW 15 45114567 missense unknown
R5787:Kcnv1 UTSW 15 45114330 missense probably damaging 1.00
R5980:Kcnv1 UTSW 15 45109414 missense probably damaging 0.99
R6819:Kcnv1 UTSW 15 45109117 missense probably damaging 0.99
R6851:Kcnv1 UTSW 15 45109198 missense probably damaging 1.00
R6997:Kcnv1 UTSW 15 45114601 missense unknown
R7254:Kcnv1 UTSW 15 45113208 missense probably benign 0.00
R7258:Kcnv1 UTSW 15 45109315 missense probably damaging 0.99
R7272:Kcnv1 UTSW 15 45113180 missense probably benign 0.00
R7367:Kcnv1 UTSW 15 45109242 missense probably damaging 1.00
R7995:Kcnv1 UTSW 15 45109347 missense probably damaging 1.00
X0026:Kcnv1 UTSW 15 45109467 missense possibly damaging 0.69
Z1177:Kcnv1 UTSW 15 45114435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTACCTTCAGCCAAGACGC -3'
(R):5'- AGCAAGCTCTGTCCTGCTTC -3'

Sequencing Primer
(F):5'- CCTATTCGCAGAGCTGGAGTAGAC -3'
(R):5'- CAAACTGGCCGTAGTGGTG -3'
Posted On2016-11-09