Incidental Mutation 'R5670:Ilkap'
ID 442544
Institutional Source Beutler Lab
Gene Symbol Ilkap
Ensembl Gene ENSMUSG00000026309
Gene Name integrin-linked kinase-associated serine/threonine phosphatase 2C
Synonyms 1600009O09Rik, PP2C-DELTA, 0710007A14Rik
MMRRC Submission 043313-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.217) question?
Stock # R5670 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 91301583-91326537 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 91318863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 38 (T38A)
Ref Sequence ENSEMBL: ENSMUSP00000140074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027534] [ENSMUST00000186986] [ENSMUST00000187306] [ENSMUST00000190519] [ENSMUST00000187678]
AlphaFold Q8R0F6
Predicted Effect probably benign
Transcript: ENSMUST00000027534
AA Change: T38A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027534
Gene: ENSMUSG00000026309
AA Change: T38A

DomainStartEndE-ValueType
Blast:PP2C_SIG 26 64 4e-12 BLAST
PP2Cc 94 388 4.47e-93 SMART
PP2C_SIG 128 390 9.82e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186433
Predicted Effect probably benign
Transcript: ENSMUST00000186986
AA Change: T38A

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140074
Gene: ENSMUSG00000026309
AA Change: T38A

DomainStartEndE-ValueType
Blast:PP2Cc 7 72 9e-24 BLAST
low complexity region 83 96 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000187049
AA Change: T36A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187105
Predicted Effect probably benign
Transcript: ENSMUST00000187306
AA Change: T38A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000139834
Gene: ENSMUSG00000026309
AA Change: T38A

DomainStartEndE-ValueType
Blast:PP2Cc 7 73 2e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000190519
AA Change: T38A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140048
Gene: ENSMUSG00000026309
AA Change: T38A

DomainStartEndE-ValueType
Blast:PP2C_SIG 26 136 2e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000187678
AA Change: T38A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189651
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protein serine/threonine phosphatase of the PP2C family. This protein can interact with integrin-linked kinase (ILK/ILK1), a regulator of integrin mediated signaling, and regulate the kinase activity of ILK. Through the interaction with ILK, this protein may selectively affect the signaling process of ILK-mediated glycogen synthase kinase 3 beta (GSK3beta), and thus participate in Wnt signaling pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null gene trap insertion exhibit enhanced motor coordination, and male homozygous mice exhibit increased cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 100,127,068 (GRCm39) probably benign Het
Ahsg T A 16: 22,716,913 (GRCm39) N158K probably benign Het
Arhgef10 T C 8: 15,004,774 (GRCm39) M430T probably benign Het
Becn2 C T 1: 175,749,179 (GRCm39) T415M probably damaging Het
Bmper T A 9: 23,384,759 (GRCm39) M588K probably damaging Het
Btla A T 16: 45,070,782 (GRCm39) D247V probably damaging Het
Cap2 T A 13: 46,684,559 (GRCm39) probably null Het
Chd2 A T 7: 73,091,465 (GRCm39) I1592K probably benign Het
Col4a4 A G 1: 82,463,300 (GRCm39) probably null Het
Copg1 C T 6: 87,889,217 (GRCm39) T853M probably damaging Het
Ddb2 C T 2: 91,042,926 (GRCm39) V353M probably damaging Het
Dip2b A G 15: 100,087,985 (GRCm39) D973G possibly damaging Het
Dscam G A 16: 96,519,364 (GRCm39) T791I probably benign Het
Dtd2 T A 12: 52,046,643 (GRCm39) L65F probably damaging Het
Fer1l6 C T 15: 58,494,331 (GRCm39) P1175S probably benign Het
Fzd6 A T 15: 38,894,510 (GRCm39) R225S probably benign Het
Glce A G 9: 61,967,793 (GRCm39) S453P probably damaging Het
Gm4787 G A 12: 81,424,805 (GRCm39) T451I probably benign Het
Igkv8-18 C T 6: 70,333,133 (GRCm39) T25I probably benign Het
Ikzf2 A G 1: 69,617,059 (GRCm39) V96A probably benign Het
Lpin3 A G 2: 160,739,250 (GRCm39) T353A probably benign Het
Mfsd8 A T 3: 40,776,484 (GRCm39) N389K probably benign Het
Mttp A T 3: 137,830,874 (GRCm39) V65D probably damaging Het
Ndufaf4 A T 4: 24,898,636 (GRCm39) D64V probably damaging Het
Nfe2l2 T C 2: 75,507,462 (GRCm39) T213A probably benign Het
Nkain4 A G 2: 180,584,995 (GRCm39) L73P probably damaging Het
Nwd1 T A 8: 73,419,745 (GRCm39) S977T probably damaging Het
Or1l4 T A 2: 37,092,006 (GRCm39) V251D probably benign Het
Or2y1d T G 11: 49,322,035 (GRCm39) L244R probably damaging Het
Or4b12 T C 2: 90,096,308 (GRCm39) I155M probably benign Het
Or5k1 G A 16: 58,617,424 (GRCm39) P262S possibly damaging Het
Pdgfra T C 5: 75,334,156 (GRCm39) S410P probably benign Het
Phldb1 T C 9: 44,627,078 (GRCm39) M456V probably damaging Het
Pi16 C T 17: 29,545,870 (GRCm39) T216I probably damaging Het
Plekha2 C A 8: 25,549,254 (GRCm39) A177S probably benign Het
Pramel29 A G 4: 143,936,192 (GRCm39) S23P probably benign Het
Prss16 C T 13: 22,187,221 (GRCm39) V450I possibly damaging Het
Rab3gap2 T A 1: 185,009,402 (GRCm39) L1086H probably damaging Het
Rab3gap2 C T 1: 184,954,096 (GRCm39) P56L probably benign Het
Rgs21 A G 1: 144,412,680 (GRCm39) V48A probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rnf213 A G 11: 119,325,512 (GRCm39) probably null Het
Slc4a2 G T 5: 24,639,836 (GRCm39) V506L probably damaging Het
Sptbn5 C G 2: 119,916,048 (GRCm39) probably benign Het
Steap2 C T 5: 5,723,681 (GRCm39) V400I probably benign Het
Syne2 G A 12: 75,997,733 (GRCm39) G2236D probably benign Het
Tespa1 T C 10: 130,190,624 (GRCm39) S84P probably damaging Het
Tlx2 G A 6: 83,046,807 (GRCm39) A85V possibly damaging Het
Tm4sf1 A T 3: 57,200,508 (GRCm39) F65I probably benign Het
Tmprss13 A G 9: 45,256,253 (GRCm39) I456V probably damaging Het
Tpte C T 8: 22,817,764 (GRCm39) S250F probably damaging Het
Trim24 T C 6: 37,942,536 (GRCm39) F946S probably benign Het
Vmn2r10 A T 5: 109,146,910 (GRCm39) Y459* probably null Het
Vps54 T A 11: 21,214,864 (GRCm39) I112N probably damaging Het
Vwa1 A G 4: 155,858,922 (GRCm39) L13P probably damaging Het
Zfp648 C A 1: 154,079,963 (GRCm39) Q41K probably benign Het
Other mutations in Ilkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Ilkap APN 1 91,312,960 (GRCm39) critical splice donor site probably null
PIT4445001:Ilkap UTSW 1 91,313,067 (GRCm39) missense probably benign
R0184:Ilkap UTSW 1 91,304,027 (GRCm39) unclassified probably benign
R0782:Ilkap UTSW 1 91,306,272 (GRCm39) missense probably damaging 1.00
R1366:Ilkap UTSW 1 91,314,937 (GRCm39) missense possibly damaging 0.58
R1552:Ilkap UTSW 1 91,312,316 (GRCm39) missense probably damaging 1.00
R2155:Ilkap UTSW 1 91,312,345 (GRCm39) missense possibly damaging 0.65
R3946:Ilkap UTSW 1 91,314,972 (GRCm39) missense probably damaging 1.00
R4005:Ilkap UTSW 1 91,312,985 (GRCm39) missense probably benign 0.03
R4860:Ilkap UTSW 1 91,315,105 (GRCm39) unclassified probably benign
R5666:Ilkap UTSW 1 91,318,863 (GRCm39) missense probably benign 0.38
R7324:Ilkap UTSW 1 91,313,115 (GRCm39) splice site probably null
R8493:Ilkap UTSW 1 91,306,266 (GRCm39) missense probably damaging 1.00
R8548:Ilkap UTSW 1 91,318,882 (GRCm39) missense possibly damaging 0.81
R9227:Ilkap UTSW 1 91,314,937 (GRCm39) missense probably benign 0.41
R9230:Ilkap UTSW 1 91,314,937 (GRCm39) missense probably benign 0.41
R9620:Ilkap UTSW 1 91,303,973 (GRCm39) missense
R9694:Ilkap UTSW 1 91,303,973 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGGTCTTTCTGCCTTACCTGAG -3'
(R):5'- ATAGAAAATAGCTGTCCTGACGAG -3'

Sequencing Primer
(F):5'- TTACCTGAGGCCATGAGTTCAAAAC -3'
(R):5'- GGTGTGTTCCCTGTAGAA -3'
Posted On 2016-11-09