Incidental Mutation 'R5670:Olfr1271'
ID442552
Institutional Source Beutler Lab
Gene Symbol Olfr1271
Ensembl Gene ENSMUSG00000075062
Gene Nameolfactory receptor 1271
SynonymsGA_x6K02T2Q125-51620802-51619885, MOR227-5
MMRRC Submission 043313-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5670 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90260546-90271032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90265964 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 155 (I155M)
Ref Sequence ENSEMBL: ENSMUSP00000149028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099751] [ENSMUST00000216383]
Predicted Effect probably benign
Transcript: ENSMUST00000099751
AA Change: I155M

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097340
Gene: ENSMUSG00000075062
AA Change: I155M

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.1e-50 PFAM
Pfam:7tm_1 39 285 6.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216383
AA Change: I155M

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217396
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 99,979,209 probably benign Het
Ahsg T A 16: 22,898,163 N158K probably benign Het
Arhgef10 T C 8: 14,954,774 M430T probably benign Het
Bmper T A 9: 23,473,463 M588K probably damaging Het
Btla A T 16: 45,250,419 D247V probably damaging Het
C87977 A G 4: 144,209,622 S23P probably benign Het
Cap2 T A 13: 46,531,083 probably null Het
Chd2 A T 7: 73,441,717 I1592K probably benign Het
Col4a4 A G 1: 82,485,579 probably null Het
Copg1 C T 6: 87,912,235 T853M probably damaging Het
Ddb2 C T 2: 91,212,581 V353M probably damaging Het
Dip2b A G 15: 100,190,104 D973G possibly damaging Het
Dscam G A 16: 96,718,164 T791I probably benign Het
Dtd2 T A 12: 51,999,860 L65F probably damaging Het
Fer1l6 C T 15: 58,622,482 P1175S probably benign Het
Fzd6 A T 15: 39,031,115 R225S probably benign Het
Glce A G 9: 62,060,511 S453P probably damaging Het
Gm38100 C T 1: 175,921,613 T415M probably damaging Het
Gm4787 G A 12: 81,378,031 T451I probably benign Het
Igkv8-18 C T 6: 70,356,149 T25I probably benign Het
Ikzf2 A G 1: 69,577,900 V96A probably benign Het
Ilkap T C 1: 91,391,141 T38A probably benign Het
Lpin3 A G 2: 160,897,330 T353A probably benign Het
Mfsd8 A T 3: 40,822,049 N389K probably benign Het
Mttp A T 3: 138,125,113 V65D probably damaging Het
Ndufaf4 A T 4: 24,898,636 D64V probably damaging Het
Nfe2l2 T C 2: 75,677,118 T213A probably benign Het
Nkain4 A G 2: 180,943,202 L73P probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1389 T G 11: 49,431,208 L244R probably damaging Het
Olfr173 G A 16: 58,797,061 P262S possibly damaging Het
Olfr365 T A 2: 37,201,994 V251D probably benign Het
Pdgfra T C 5: 75,173,495 S410P probably benign Het
Phldb1 T C 9: 44,715,781 M456V probably damaging Het
Pi16 C T 17: 29,326,896 T216I probably damaging Het
Plekha2 C A 8: 25,059,238 A177S probably benign Het
Prss16 C T 13: 22,003,051 V450I possibly damaging Het
Rab3gap2 C T 1: 185,221,899 P56L probably benign Het
Rab3gap2 T A 1: 185,277,205 L1086H probably damaging Het
Rgs21 A G 1: 144,536,942 V48A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 A G 11: 119,434,686 probably null Het
Slc4a2 G T 5: 24,434,838 V506L probably damaging Het
Sptbn5 C G 2: 120,085,567 probably benign Het
Steap2 C T 5: 5,673,681 V400I probably benign Het
Syne2 G A 12: 75,950,959 G2236D probably benign Het
Tespa1 T C 10: 130,354,755 S84P probably damaging Het
Tlx2 G A 6: 83,069,826 A85V possibly damaging Het
Tm4sf1 A T 3: 57,293,087 F65I probably benign Het
Tmprss13 A G 9: 45,344,955 I456V probably damaging Het
Tpte C T 8: 22,327,748 S250F probably damaging Het
Trim24 T C 6: 37,965,601 F946S probably benign Het
Vmn2r10 A T 5: 108,999,044 Y459* probably null Het
Vps54 T A 11: 21,264,864 I112N probably damaging Het
Vwa1 A G 4: 155,774,465 L13P probably damaging Het
Zfp648 C A 1: 154,204,217 Q41K probably benign Het
Other mutations in Olfr1271
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Olfr1271 APN 2 90265951 missense probably damaging 0.97
IGL02901:Olfr1271 APN 2 90265708 missense probably damaging 1.00
PIT4466001:Olfr1271 UTSW 2 90266295 missense probably damaging 0.97
PIT4468001:Olfr1271 UTSW 2 90266220 missense probably benign 0.00
R0325:Olfr1271 UTSW 2 90265536 missense probably null
R1350:Olfr1271 UTSW 2 90266346 missense probably damaging 0.97
R1888:Olfr1271 UTSW 2 90265569 missense probably damaging 1.00
R1888:Olfr1271 UTSW 2 90265569 missense probably damaging 1.00
R2509:Olfr1271 UTSW 2 90265686 missense possibly damaging 0.91
R2510:Olfr1271 UTSW 2 90265606 missense probably damaging 0.98
R4113:Olfr1271 UTSW 2 90266340 missense probably damaging 1.00
R5414:Olfr1271 UTSW 2 90265702 missense probably benign 0.07
R5580:Olfr1271 UTSW 2 90266350 missense probably benign 0.00
R5664:Olfr1271 UTSW 2 90265615 missense probably damaging 0.96
R5666:Olfr1271 UTSW 2 90265964 missense probably benign 0.04
R5881:Olfr1271 UTSW 2 90266442 unclassified probably null
R6493:Olfr1271 UTSW 2 90265708 missense probably damaging 1.00
R7688:Olfr1271 UTSW 2 90265615 missense probably damaging 0.96
R7719:Olfr1271 UTSW 2 90266259 missense probably damaging 1.00
R8041:Olfr1271 UTSW 2 90266144 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTCAAGCTGATTAGGATGACAG -3'
(R):5'- CATCTCTCTGAAGGGCTGTC -3'

Sequencing Primer
(F):5'- TGACAGCATAGGAGGACACC -3'
(R):5'- CTCTGAAGGGCTGTCTAACTCAG -3'
Posted On2016-11-09