Incidental Mutation 'R5670:Lpin3'
ID442555
Institutional Source Beutler Lab
Gene Symbol Lpin3
Ensembl Gene ENSMUSG00000027412
Gene Namelipin 3
Synonyms9130206L11Rik
MMRRC Submission 043313-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5670 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location160880670-160906002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 160897330 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 353 (T353A)
Ref Sequence ENSEMBL: ENSMUSP00000105083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109457]
Predicted Effect probably benign
Transcript: ENSMUST00000040872
AA Change: T353A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412
AA Change: T353A

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109455
AA Change: T353A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412
AA Change: T353A

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109456
AA Change: T353A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412
AA Change: T353A

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109457
AA Change: T353A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412
AA Change: T353A

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124920
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the lipin family of proteins, and all family members share strong homology in their C-terminal region. This protein is thought to form hetero-oligomers with other lipin family members, while one family member, lipin 1, can also form homo-oligomers. This protein contains conserved motifs for phosphatidate phosphatase 1 (PAP1) activity as well as a domain that interacts with a transcriptional co-activator. Lipin complexes act in the cytoplasm to catalyze the dephosphorylation of phosphatidic acid to produce diacylglycerol, which is the precursor of both triglycerides and phospholipids. Lipin complexes are also thought to regulate gene expression as transcriptional co-activators in the nucleus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 99,979,209 probably benign Het
Ahsg T A 16: 22,898,163 N158K probably benign Het
Arhgef10 T C 8: 14,954,774 M430T probably benign Het
Bmper T A 9: 23,473,463 M588K probably damaging Het
Btla A T 16: 45,250,419 D247V probably damaging Het
C87977 A G 4: 144,209,622 S23P probably benign Het
Cap2 T A 13: 46,531,083 probably null Het
Chd2 A T 7: 73,441,717 I1592K probably benign Het
Col4a4 A G 1: 82,485,579 probably null Het
Copg1 C T 6: 87,912,235 T853M probably damaging Het
Ddb2 C T 2: 91,212,581 V353M probably damaging Het
Dip2b A G 15: 100,190,104 D973G possibly damaging Het
Dscam G A 16: 96,718,164 T791I probably benign Het
Dtd2 T A 12: 51,999,860 L65F probably damaging Het
Fer1l6 C T 15: 58,622,482 P1175S probably benign Het
Fzd6 A T 15: 39,031,115 R225S probably benign Het
Glce A G 9: 62,060,511 S453P probably damaging Het
Gm38100 C T 1: 175,921,613 T415M probably damaging Het
Gm4787 G A 12: 81,378,031 T451I probably benign Het
Igkv8-18 C T 6: 70,356,149 T25I probably benign Het
Ikzf2 A G 1: 69,577,900 V96A probably benign Het
Ilkap T C 1: 91,391,141 T38A probably benign Het
Mfsd8 A T 3: 40,822,049 N389K probably benign Het
Mttp A T 3: 138,125,113 V65D probably damaging Het
Ndufaf4 A T 4: 24,898,636 D64V probably damaging Het
Nfe2l2 T C 2: 75,677,118 T213A probably benign Het
Nkain4 A G 2: 180,943,202 L73P probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1271 T C 2: 90,265,964 I155M probably benign Het
Olfr1389 T G 11: 49,431,208 L244R probably damaging Het
Olfr173 G A 16: 58,797,061 P262S possibly damaging Het
Olfr365 T A 2: 37,201,994 V251D probably benign Het
Pdgfra T C 5: 75,173,495 S410P probably benign Het
Phldb1 T C 9: 44,715,781 M456V probably damaging Het
Pi16 C T 17: 29,326,896 T216I probably damaging Het
Plekha2 C A 8: 25,059,238 A177S probably benign Het
Prss16 C T 13: 22,003,051 V450I possibly damaging Het
Rab3gap2 C T 1: 185,221,899 P56L probably benign Het
Rab3gap2 T A 1: 185,277,205 L1086H probably damaging Het
Rgs21 A G 1: 144,536,942 V48A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 A G 11: 119,434,686 probably null Het
Slc4a2 G T 5: 24,434,838 V506L probably damaging Het
Sptbn5 C G 2: 120,085,567 probably benign Het
Steap2 C T 5: 5,673,681 V400I probably benign Het
Syne2 G A 12: 75,950,959 G2236D probably benign Het
Tespa1 T C 10: 130,354,755 S84P probably damaging Het
Tlx2 G A 6: 83,069,826 A85V possibly damaging Het
Tm4sf1 A T 3: 57,293,087 F65I probably benign Het
Tmprss13 A G 9: 45,344,955 I456V probably damaging Het
Tpte C T 8: 22,327,748 S250F probably damaging Het
Trim24 T C 6: 37,965,601 F946S probably benign Het
Vmn2r10 A T 5: 108,999,044 Y459* probably null Het
Vps54 T A 11: 21,264,864 I112N probably damaging Het
Vwa1 A G 4: 155,774,465 L13P probably damaging Het
Zfp648 C A 1: 154,204,217 Q41K probably benign Het
Other mutations in Lpin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Lpin3 APN 2 160893998 missense probably damaging 1.00
IGL01373:Lpin3 APN 2 160903729 missense probably damaging 1.00
IGL01576:Lpin3 APN 2 160897127 missense probably benign 0.02
IGL02124:Lpin3 APN 2 160895833 critical splice donor site probably null
IGL02272:Lpin3 APN 2 160901661 missense probably benign 0.15
IGL02314:Lpin3 APN 2 160898718 nonsense probably null
IGL02374:Lpin3 APN 2 160895838 splice site probably benign
IGL02554:Lpin3 APN 2 160896787 missense probably damaging 1.00
IGL02693:Lpin3 APN 2 160905055 missense probably damaging 1.00
IGL02858:Lpin3 APN 2 160898620 splice site probably benign
IGL03143:Lpin3 APN 2 160903598 splice site probably benign
R0100:Lpin3 UTSW 2 160905340 missense probably damaging 1.00
R0100:Lpin3 UTSW 2 160905340 missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160898681 missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160898681 missense probably damaging 1.00
R0329:Lpin3 UTSW 2 160905305 missense probably benign
R0330:Lpin3 UTSW 2 160905305 missense probably benign
R0570:Lpin3 UTSW 2 160904024 splice site probably benign
R0633:Lpin3 UTSW 2 160903974 missense probably damaging 0.99
R0781:Lpin3 UTSW 2 160894079 missense probably benign 0.03
R1109:Lpin3 UTSW 2 160899021 missense probably damaging 1.00
R1110:Lpin3 UTSW 2 160894079 missense probably benign 0.03
R1404:Lpin3 UTSW 2 160892390 critical splice donor site probably null
R1404:Lpin3 UTSW 2 160892390 critical splice donor site probably null
R1513:Lpin3 UTSW 2 160904548 missense probably damaging 1.00
R1543:Lpin3 UTSW 2 160895390 missense possibly damaging 0.69
R1785:Lpin3 UTSW 2 160896809 nonsense probably null
R1786:Lpin3 UTSW 2 160896809 nonsense probably null
R1896:Lpin3 UTSW 2 160905298 missense probably damaging 1.00
R4440:Lpin3 UTSW 2 160898645 missense probably benign
R4470:Lpin3 UTSW 2 160895434 missense probably benign 0.00
R4996:Lpin3 UTSW 2 160905287 missense probably damaging 1.00
R5014:Lpin3 UTSW 2 160904828 missense probably damaging 1.00
R5124:Lpin3 UTSW 2 160897061 missense probably benign
R5184:Lpin3 UTSW 2 160897138 missense probably benign
R5405:Lpin3 UTSW 2 160903929 missense probably damaging 1.00
R5442:Lpin3 UTSW 2 160905016 missense probably damaging 1.00
R5666:Lpin3 UTSW 2 160897330 missense probably benign
R5693:Lpin3 UTSW 2 160895400 missense probably benign 0.00
R6084:Lpin3 UTSW 2 160895801 missense probably benign 0.38
R6994:Lpin3 UTSW 2 160904883 missense probably damaging 1.00
R7090:Lpin3 UTSW 2 160896752 missense probably damaging 0.96
R7157:Lpin3 UTSW 2 160898707 missense probably benign 0.02
R7207:Lpin3 UTSW 2 160894003 nonsense probably null
R7430:Lpin3 UTSW 2 160898666 missense probably benign 0.06
R7459:Lpin3 UTSW 2 160897300 missense probably benign 0.06
R7603:Lpin3 UTSW 2 160903754 splice site probably null
R7644:Lpin3 UTSW 2 160896770 missense probably benign 0.02
R7706:Lpin3 UTSW 2 160905290 missense probably damaging 1.00
R7803:Lpin3 UTSW 2 160895390 missense possibly damaging 0.69
X0002:Lpin3 UTSW 2 160903717 missense probably damaging 1.00
Z1088:Lpin3 UTSW 2 160892231 missense probably damaging 0.99
Z1176:Lpin3 UTSW 2 160899785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTCAGGGCTGATACATTCC -3'
(R):5'- AATGGCTCTGTTCTATCTGGTC -3'

Sequencing Primer
(F):5'- GATACATTCCATCCTGCTGTGGAG -3'
(R):5'- ATTTGGCTCCTCCATGGGACTG -3'
Posted On2016-11-09