Incidental Mutation 'R5670:C87977'
ID 442562
Institutional Source Beutler Lab
Gene Symbol C87977
Ensembl Gene ENSMUSG00000046262
Gene Name expressed sequence C87977
Synonyms
MMRRC Submission 043313-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R5670 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 144206775-144213318 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144209622 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 23 (S23P)
Ref Sequence ENSEMBL: ENSMUSP00000119895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105753] [ENSMUST00000105754] [ENSMUST00000105755] [ENSMUST00000105757] [ENSMUST00000146836] [ENSMUST00000147855]
AlphaFold A2A958
Predicted Effect probably benign
Transcript: ENSMUST00000105753
AA Change: S21P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000105754
AA Change: S21P

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000105755
SMART Domains Protein: ENSMUSP00000101381
Gene: ENSMUSG00000046262

DomainStartEndE-ValueType
SCOP:d1a4ya_ 52 250 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105757
AA Change: S21P

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101383
Gene: ENSMUSG00000046262
AA Change: S21P

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 420 1e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132946
Predicted Effect probably benign
Transcript: ENSMUST00000146836
Predicted Effect probably benign
Transcript: ENSMUST00000147855
AA Change: S23P

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 99,979,209 probably benign Het
Ahsg T A 16: 22,898,163 N158K probably benign Het
Arhgef10 T C 8: 14,954,774 M430T probably benign Het
Bmper T A 9: 23,473,463 M588K probably damaging Het
Btla A T 16: 45,250,419 D247V probably damaging Het
Cap2 T A 13: 46,531,083 probably null Het
Chd2 A T 7: 73,441,717 I1592K probably benign Het
Col4a4 A G 1: 82,485,579 probably null Het
Copg1 C T 6: 87,912,235 T853M probably damaging Het
Ddb2 C T 2: 91,212,581 V353M probably damaging Het
Dip2b A G 15: 100,190,104 D973G possibly damaging Het
Dscam G A 16: 96,718,164 T791I probably benign Het
Dtd2 T A 12: 51,999,860 L65F probably damaging Het
Fer1l6 C T 15: 58,622,482 P1175S probably benign Het
Fzd6 A T 15: 39,031,115 R225S probably benign Het
Glce A G 9: 62,060,511 S453P probably damaging Het
Gm38100 C T 1: 175,921,613 T415M probably damaging Het
Gm4787 G A 12: 81,378,031 T451I probably benign Het
Igkv8-18 C T 6: 70,356,149 T25I probably benign Het
Ikzf2 A G 1: 69,577,900 V96A probably benign Het
Ilkap T C 1: 91,391,141 T38A probably benign Het
Lpin3 A G 2: 160,897,330 T353A probably benign Het
Mfsd8 A T 3: 40,822,049 N389K probably benign Het
Mttp A T 3: 138,125,113 V65D probably damaging Het
Ndufaf4 A T 4: 24,898,636 D64V probably damaging Het
Nfe2l2 T C 2: 75,677,118 T213A probably benign Het
Nkain4 A G 2: 180,943,202 L73P probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1271 T C 2: 90,265,964 I155M probably benign Het
Olfr1389 T G 11: 49,431,208 L244R probably damaging Het
Olfr173 G A 16: 58,797,061 P262S possibly damaging Het
Olfr365 T A 2: 37,201,994 V251D probably benign Het
Pdgfra T C 5: 75,173,495 S410P probably benign Het
Phldb1 T C 9: 44,715,781 M456V probably damaging Het
Pi16 C T 17: 29,326,896 T216I probably damaging Het
Plekha2 C A 8: 25,059,238 A177S probably benign Het
Prss16 C T 13: 22,003,051 V450I possibly damaging Het
Rab3gap2 C T 1: 185,221,899 P56L probably benign Het
Rab3gap2 T A 1: 185,277,205 L1086H probably damaging Het
Rgs21 A G 1: 144,536,942 V48A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 A G 11: 119,434,686 probably null Het
Slc4a2 G T 5: 24,434,838 V506L probably damaging Het
Sptbn5 C G 2: 120,085,567 probably benign Het
Steap2 C T 5: 5,673,681 V400I probably benign Het
Syne2 G A 12: 75,950,959 G2236D probably benign Het
Tespa1 T C 10: 130,354,755 S84P probably damaging Het
Tlx2 G A 6: 83,069,826 A85V possibly damaging Het
Tm4sf1 A T 3: 57,293,087 F65I probably benign Het
Tmprss13 A G 9: 45,344,955 I456V probably damaging Het
Tpte C T 8: 22,327,748 S250F probably damaging Het
Trim24 T C 6: 37,965,601 F946S probably benign Het
Vmn2r10 A T 5: 108,999,044 Y459* probably null Het
Vps54 T A 11: 21,264,864 I112N probably damaging Het
Vwa1 A G 4: 155,774,465 L13P probably damaging Het
Zfp648 C A 1: 154,204,217 Q41K probably benign Het
Other mutations in C87977
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:C87977 APN 4 144208475 missense possibly damaging 0.58
IGL02950:C87977 APN 4 144212961 missense probably benign 0.06
IGL03174:C87977 APN 4 144208430 missense probably benign
IGL03178:C87977 APN 4 144208251 critical splice donor site probably null
PIT4812001:C87977 UTSW 4 144209516 missense probably benign
R0622:C87977 UTSW 4 144213013 unclassified probably benign
R0634:C87977 UTSW 4 144209340 critical splice donor site probably null
R1127:C87977 UTSW 4 144207124 missense probably damaging 1.00
R1341:C87977 UTSW 4 144207559 missense probably damaging 1.00
R1697:C87977 UTSW 4 144208592 missense probably damaging 1.00
R1827:C87977 UTSW 4 144209610 missense probably damaging 0.99
R1857:C87977 UTSW 4 144208521 missense possibly damaging 0.74
R2859:C87977 UTSW 4 144209622 missense probably benign 0.11
R4063:C87977 UTSW 4 144208695 missense possibly damaging 0.87
R4114:C87977 UTSW 4 144209603 missense probably damaging 1.00
R4130:C87977 UTSW 4 144208809 missense probably damaging 0.99
R4255:C87977 UTSW 4 144207484 missense possibly damaging 0.68
R4704:C87977 UTSW 4 144208592 missense probably damaging 1.00
R4840:C87977 UTSW 4 144208574 missense probably damaging 0.98
R5267:C87977 UTSW 4 144213005 unclassified probably benign
R6149:C87977 UTSW 4 144207413 missense probably damaging 0.98
R6508:C87977 UTSW 4 144207601 nonsense probably null
R6528:C87977 UTSW 4 144208811 missense probably damaging 0.99
R7252:C87977 UTSW 4 144212940 missense possibly damaging 0.95
R7564:C87977 UTSW 4 144212955 missense probably damaging 1.00
R7704:C87977 UTSW 4 144208521 missense possibly damaging 0.74
R8737:C87977 UTSW 4 144208622 missense probably damaging 1.00
Z1176:C87977 UTSW 4 144207461 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACGCAGGTATCATGGCCTTC -3'
(R):5'- AAGGGCAGACCAAGCAGTTC -3'

Sequencing Primer
(F):5'- GCAGGTATCATGGCCTTCAAGATC -3'
(R):5'- CAAGTCTCACTGAGGTCTAGGAC -3'
Posted On 2016-11-09