Incidental Mutation 'R5670:Igkv8-18'
ID442572
Institutional Source Beutler Lab
Gene Symbol Igkv8-18
Ensembl Gene ENSMUSG00000076589
Gene Nameimmunoglobulin kappa variable 8-18
Synonyms
MMRRC Submission 043313-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R5670 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location70355877-70356445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70356149 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 25 (T25I)
Ref Sequence ENSEMBL: ENSMUSP00000100191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103390]
Predicted Effect probably benign
Transcript: ENSMUST00000103390
AA Change: T25I

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100191
Gene: ENSMUSG00000076589
AA Change: T25I

DomainStartEndE-ValueType
IGv 38 116 1.28e-19 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 99,979,209 probably benign Het
Ahsg T A 16: 22,898,163 N158K probably benign Het
Arhgef10 T C 8: 14,954,774 M430T probably benign Het
Bmper T A 9: 23,473,463 M588K probably damaging Het
Btla A T 16: 45,250,419 D247V probably damaging Het
C87977 A G 4: 144,209,622 S23P probably benign Het
Cap2 T A 13: 46,531,083 probably null Het
Chd2 A T 7: 73,441,717 I1592K probably benign Het
Col4a4 A G 1: 82,485,579 probably null Het
Copg1 C T 6: 87,912,235 T853M probably damaging Het
Ddb2 C T 2: 91,212,581 V353M probably damaging Het
Dip2b A G 15: 100,190,104 D973G possibly damaging Het
Dscam G A 16: 96,718,164 T791I probably benign Het
Dtd2 T A 12: 51,999,860 L65F probably damaging Het
Fer1l6 C T 15: 58,622,482 P1175S probably benign Het
Fzd6 A T 15: 39,031,115 R225S probably benign Het
Glce A G 9: 62,060,511 S453P probably damaging Het
Gm38100 C T 1: 175,921,613 T415M probably damaging Het
Gm4787 G A 12: 81,378,031 T451I probably benign Het
Ikzf2 A G 1: 69,577,900 V96A probably benign Het
Ilkap T C 1: 91,391,141 T38A probably benign Het
Lpin3 A G 2: 160,897,330 T353A probably benign Het
Mfsd8 A T 3: 40,822,049 N389K probably benign Het
Mttp A T 3: 138,125,113 V65D probably damaging Het
Ndufaf4 A T 4: 24,898,636 D64V probably damaging Het
Nfe2l2 T C 2: 75,677,118 T213A probably benign Het
Nkain4 A G 2: 180,943,202 L73P probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1271 T C 2: 90,265,964 I155M probably benign Het
Olfr1389 T G 11: 49,431,208 L244R probably damaging Het
Olfr173 G A 16: 58,797,061 P262S possibly damaging Het
Olfr365 T A 2: 37,201,994 V251D probably benign Het
Pdgfra T C 5: 75,173,495 S410P probably benign Het
Phldb1 T C 9: 44,715,781 M456V probably damaging Het
Pi16 C T 17: 29,326,896 T216I probably damaging Het
Plekha2 C A 8: 25,059,238 A177S probably benign Het
Prss16 C T 13: 22,003,051 V450I possibly damaging Het
Rab3gap2 C T 1: 185,221,899 P56L probably benign Het
Rab3gap2 T A 1: 185,277,205 L1086H probably damaging Het
Rgs21 A G 1: 144,536,942 V48A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 A G 11: 119,434,686 probably null Het
Slc4a2 G T 5: 24,434,838 V506L probably damaging Het
Sptbn5 C G 2: 120,085,567 probably benign Het
Steap2 C T 5: 5,673,681 V400I probably benign Het
Syne2 G A 12: 75,950,959 G2236D probably benign Het
Tespa1 T C 10: 130,354,755 S84P probably damaging Het
Tlx2 G A 6: 83,069,826 A85V possibly damaging Het
Tm4sf1 A T 3: 57,293,087 F65I probably benign Het
Tmprss13 A G 9: 45,344,955 I456V probably damaging Het
Tpte C T 8: 22,327,748 S250F probably damaging Het
Trim24 T C 6: 37,965,601 F946S probably benign Het
Vmn2r10 A T 5: 108,999,044 Y459* probably null Het
Vps54 T A 11: 21,264,864 I112N probably damaging Het
Vwa1 A G 4: 155,774,465 L13P probably damaging Het
Zfp648 C A 1: 154,204,217 Q41K probably benign Het
Other mutations in Igkv8-18
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0058:Igkv8-18 UTSW 6 70356121 splice site probably benign
R4731:Igkv8-18 UTSW 6 70356296 missense probably damaging 1.00
R4732:Igkv8-18 UTSW 6 70356296 missense probably damaging 1.00
R4733:Igkv8-18 UTSW 6 70356296 missense probably damaging 1.00
R5857:Igkv8-18 UTSW 6 70355920 missense probably benign 0.00
R7152:Igkv8-18 UTSW 6 70356221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGACCCATGTCCTCATGTTC -3'
(R):5'- GAATCGATCAGGGACCCAAG -3'

Sequencing Primer
(F):5'- CTCATGTTCTTGCTGCTTTGGGTATC -3'
(R):5'- GGACCCAAGATTCTCTAATGGATGC -3'
Posted On2016-11-09