Incidental Mutation 'R5670:Cap2'
ID 442594
Institutional Source Beutler Lab
Gene Symbol Cap2
Ensembl Gene ENSMUSG00000021373
Gene Name cyclase associated actin cytoskeleton regulatory protein 2
Synonyms 2810452G09Rik
MMRRC Submission 043313-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R5670 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 46655379-46803757 bp(+) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to A at 46684559 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021802] [ENSMUST00000119341] [ENSMUST00000225824]
AlphaFold Q9CYT6
Predicted Effect probably null
Transcript: ENSMUST00000021802
SMART Domains Protein: ENSMUSP00000021802
Gene: ENSMUSG00000021373

DomainStartEndE-ValueType
Pfam:CAP_N 5 301 2.6e-117 PFAM
CARP 358 395 1.06e-10 SMART
CARP 396 433 1.12e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119341
SMART Domains Protein: ENSMUSP00000112952
Gene: ENSMUSG00000021373

DomainStartEndE-ValueType
Pfam:CAP_N 4 105 1.8e-25 PFAM
Pfam:CAP_N 99 198 8.2e-29 PFAM
CARP 246 283 1.06e-10 SMART
CARP 284 321 1.12e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000225824
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are smaller, prone to eye infections and show microphthalmia, cardiac conduction defects and dilated cardiomyopathy, predominantly in males. Males are underrepresented at weaning and ~70% die suddenly by 12 weeks of age, whereas females survive at nearly expected levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 100,127,068 (GRCm39) probably benign Het
Ahsg T A 16: 22,716,913 (GRCm39) N158K probably benign Het
Arhgef10 T C 8: 15,004,774 (GRCm39) M430T probably benign Het
Becn2 C T 1: 175,749,179 (GRCm39) T415M probably damaging Het
Bmper T A 9: 23,384,759 (GRCm39) M588K probably damaging Het
Btla A T 16: 45,070,782 (GRCm39) D247V probably damaging Het
Chd2 A T 7: 73,091,465 (GRCm39) I1592K probably benign Het
Col4a4 A G 1: 82,463,300 (GRCm39) probably null Het
Copg1 C T 6: 87,889,217 (GRCm39) T853M probably damaging Het
Ddb2 C T 2: 91,042,926 (GRCm39) V353M probably damaging Het
Dip2b A G 15: 100,087,985 (GRCm39) D973G possibly damaging Het
Dscam G A 16: 96,519,364 (GRCm39) T791I probably benign Het
Dtd2 T A 12: 52,046,643 (GRCm39) L65F probably damaging Het
Fer1l6 C T 15: 58,494,331 (GRCm39) P1175S probably benign Het
Fzd6 A T 15: 38,894,510 (GRCm39) R225S probably benign Het
Glce A G 9: 61,967,793 (GRCm39) S453P probably damaging Het
Gm4787 G A 12: 81,424,805 (GRCm39) T451I probably benign Het
Igkv8-18 C T 6: 70,333,133 (GRCm39) T25I probably benign Het
Ikzf2 A G 1: 69,617,059 (GRCm39) V96A probably benign Het
Ilkap T C 1: 91,318,863 (GRCm39) T38A probably benign Het
Lpin3 A G 2: 160,739,250 (GRCm39) T353A probably benign Het
Mfsd8 A T 3: 40,776,484 (GRCm39) N389K probably benign Het
Mttp A T 3: 137,830,874 (GRCm39) V65D probably damaging Het
Ndufaf4 A T 4: 24,898,636 (GRCm39) D64V probably damaging Het
Nfe2l2 T C 2: 75,507,462 (GRCm39) T213A probably benign Het
Nkain4 A G 2: 180,584,995 (GRCm39) L73P probably damaging Het
Nwd1 T A 8: 73,419,745 (GRCm39) S977T probably damaging Het
Or1l4 T A 2: 37,092,006 (GRCm39) V251D probably benign Het
Or2y1d T G 11: 49,322,035 (GRCm39) L244R probably damaging Het
Or4b12 T C 2: 90,096,308 (GRCm39) I155M probably benign Het
Or5k1 G A 16: 58,617,424 (GRCm39) P262S possibly damaging Het
Pdgfra T C 5: 75,334,156 (GRCm39) S410P probably benign Het
Phldb1 T C 9: 44,627,078 (GRCm39) M456V probably damaging Het
Pi16 C T 17: 29,545,870 (GRCm39) T216I probably damaging Het
Plekha2 C A 8: 25,549,254 (GRCm39) A177S probably benign Het
Pramel29 A G 4: 143,936,192 (GRCm39) S23P probably benign Het
Prss16 C T 13: 22,187,221 (GRCm39) V450I possibly damaging Het
Rab3gap2 T A 1: 185,009,402 (GRCm39) L1086H probably damaging Het
Rab3gap2 C T 1: 184,954,096 (GRCm39) P56L probably benign Het
Rgs21 A G 1: 144,412,680 (GRCm39) V48A probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rnf213 A G 11: 119,325,512 (GRCm39) probably null Het
Slc4a2 G T 5: 24,639,836 (GRCm39) V506L probably damaging Het
Sptbn5 C G 2: 119,916,048 (GRCm39) probably benign Het
Steap2 C T 5: 5,723,681 (GRCm39) V400I probably benign Het
Syne2 G A 12: 75,997,733 (GRCm39) G2236D probably benign Het
Tespa1 T C 10: 130,190,624 (GRCm39) S84P probably damaging Het
Tlx2 G A 6: 83,046,807 (GRCm39) A85V possibly damaging Het
Tm4sf1 A T 3: 57,200,508 (GRCm39) F65I probably benign Het
Tmprss13 A G 9: 45,256,253 (GRCm39) I456V probably damaging Het
Tpte C T 8: 22,817,764 (GRCm39) S250F probably damaging Het
Trim24 T C 6: 37,942,536 (GRCm39) F946S probably benign Het
Vmn2r10 A T 5: 109,146,910 (GRCm39) Y459* probably null Het
Vps54 T A 11: 21,214,864 (GRCm39) I112N probably damaging Het
Vwa1 A G 4: 155,858,922 (GRCm39) L13P probably damaging Het
Zfp648 C A 1: 154,079,963 (GRCm39) Q41K probably benign Het
Other mutations in Cap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Cap2 APN 13 46,793,425 (GRCm39) splice site probably benign
IGL01927:Cap2 APN 13 46,789,109 (GRCm39) missense probably benign 0.03
IGL02213:Cap2 APN 13 46,789,087 (GRCm39) splice site probably benign
IGL02511:Cap2 APN 13 46,684,498 (GRCm39) start codon destroyed probably null 0.12
IGL02871:Cap2 APN 13 46,678,968 (GRCm39) missense probably benign 0.00
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0385:Cap2 UTSW 13 46,714,023 (GRCm39) missense probably damaging 1.00
R0387:Cap2 UTSW 13 46,713,992 (GRCm39) missense probably damaging 0.99
R0712:Cap2 UTSW 13 46,768,837 (GRCm39) splice site probably null
R1489:Cap2 UTSW 13 46,763,111 (GRCm39) missense probably damaging 1.00
R1666:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1668:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1676:Cap2 UTSW 13 46,791,335 (GRCm39) missense probably damaging 1.00
R1756:Cap2 UTSW 13 46,684,489 (GRCm39) missense probably benign 0.11
R1822:Cap2 UTSW 13 46,768,823 (GRCm39) missense probably benign 0.03
R1867:Cap2 UTSW 13 46,793,555 (GRCm39) missense probably damaging 1.00
R1972:Cap2 UTSW 13 46,791,375 (GRCm39) missense probably damaging 0.98
R1990:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1991:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1992:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R2144:Cap2 UTSW 13 46,713,978 (GRCm39) critical splice acceptor site probably null
R3039:Cap2 UTSW 13 46,793,317 (GRCm39) missense probably benign 0.20
R4024:Cap2 UTSW 13 46,791,317 (GRCm39) splice site probably benign
R4554:Cap2 UTSW 13 46,789,250 (GRCm39) missense probably damaging 1.00
R4748:Cap2 UTSW 13 46,793,302 (GRCm39) missense possibly damaging 0.64
R4821:Cap2 UTSW 13 46,763,586 (GRCm39) missense probably damaging 0.99
R4876:Cap2 UTSW 13 46,684,497 (GRCm39) start codon destroyed probably null
R4902:Cap2 UTSW 13 46,684,501 (GRCm39) missense probably damaging 0.99
R5320:Cap2 UTSW 13 46,801,840 (GRCm39) makesense probably null
R5666:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R6086:Cap2 UTSW 13 46,789,188 (GRCm39) missense probably damaging 1.00
R6728:Cap2 UTSW 13 46,793,335 (GRCm39) missense possibly damaging 0.87
R6842:Cap2 UTSW 13 46,800,101 (GRCm39) missense probably damaging 1.00
R7785:Cap2 UTSW 13 46,789,224 (GRCm39) missense probably benign
R7889:Cap2 UTSW 13 46,800,051 (GRCm39) missense probably damaging 0.99
R8065:Cap2 UTSW 13 46,791,337 (GRCm39) missense probably damaging 1.00
R8205:Cap2 UTSW 13 46,768,739 (GRCm39) missense probably damaging 1.00
R8425:Cap2 UTSW 13 46,763,208 (GRCm39) missense probably damaging 0.98
R8731:Cap2 UTSW 13 46,800,006 (GRCm39) missense probably benign 0.00
R8738:Cap2 UTSW 13 46,684,548 (GRCm39) missense probably benign 0.00
R9320:Cap2 UTSW 13 46,768,818 (GRCm39) missense probably benign 0.04
R9491:Cap2 UTSW 13 46,791,366 (GRCm39) missense possibly damaging 0.92
R9686:Cap2 UTSW 13 46,678,926 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATGTGACCTGTGGCAAG -3'
(R):5'- ACAGCCCTGATTCTAGCACTC -3'

Sequencing Primer
(F):5'- GAGTAACCAAGCCGTTCT -3'
(R):5'- GGTAGTACCTATAATACTGCAGTTGG -3'
Posted On 2016-11-09