Incidental Mutation 'R5670:Cap2'
ID442594
Institutional Source Beutler Lab
Gene Symbol Cap2
Ensembl Gene ENSMUSG00000021373
Gene NameCAP, adenylate cyclase-associated protein, 2 (yeast)
Synonyms
MMRRC Submission 043313-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R5670 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location46501848-46650281 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 46531083 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021802] [ENSMUST00000119341] [ENSMUST00000225824]
Predicted Effect probably null
Transcript: ENSMUST00000021802
SMART Domains Protein: ENSMUSP00000021802
Gene: ENSMUSG00000021373

DomainStartEndE-ValueType
Pfam:CAP_N 5 301 2.6e-117 PFAM
CARP 358 395 1.06e-10 SMART
CARP 396 433 1.12e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119341
SMART Domains Protein: ENSMUSP00000112952
Gene: ENSMUSG00000021373

DomainStartEndE-ValueType
Pfam:CAP_N 4 105 1.8e-25 PFAM
Pfam:CAP_N 99 198 8.2e-29 PFAM
CARP 246 283 1.06e-10 SMART
CARP 284 321 1.12e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000225824
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are smaller, prone to eye infections and show microphthalmia, cardiac conduction defects and dilated cardiomyopathy, predominantly in males. Males are underrepresented at weaning and ~70% die suddenly by 12 weeks of age, whereas females survive at nearly expected levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 99,979,209 probably benign Het
Ahsg T A 16: 22,898,163 N158K probably benign Het
Arhgef10 T C 8: 14,954,774 M430T probably benign Het
Bmper T A 9: 23,473,463 M588K probably damaging Het
Btla A T 16: 45,250,419 D247V probably damaging Het
C87977 A G 4: 144,209,622 S23P probably benign Het
Chd2 A T 7: 73,441,717 I1592K probably benign Het
Col4a4 A G 1: 82,485,579 probably null Het
Copg1 C T 6: 87,912,235 T853M probably damaging Het
Ddb2 C T 2: 91,212,581 V353M probably damaging Het
Dip2b A G 15: 100,190,104 D973G possibly damaging Het
Dscam G A 16: 96,718,164 T791I probably benign Het
Dtd2 T A 12: 51,999,860 L65F probably damaging Het
Fer1l6 C T 15: 58,622,482 P1175S probably benign Het
Fzd6 A T 15: 39,031,115 R225S probably benign Het
Glce A G 9: 62,060,511 S453P probably damaging Het
Gm38100 C T 1: 175,921,613 T415M probably damaging Het
Gm4787 G A 12: 81,378,031 T451I probably benign Het
Igkv8-18 C T 6: 70,356,149 T25I probably benign Het
Ikzf2 A G 1: 69,577,900 V96A probably benign Het
Ilkap T C 1: 91,391,141 T38A probably benign Het
Lpin3 A G 2: 160,897,330 T353A probably benign Het
Mfsd8 A T 3: 40,822,049 N389K probably benign Het
Mttp A T 3: 138,125,113 V65D probably damaging Het
Ndufaf4 A T 4: 24,898,636 D64V probably damaging Het
Nfe2l2 T C 2: 75,677,118 T213A probably benign Het
Nkain4 A G 2: 180,943,202 L73P probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1271 T C 2: 90,265,964 I155M probably benign Het
Olfr1389 T G 11: 49,431,208 L244R probably damaging Het
Olfr173 G A 16: 58,797,061 P262S possibly damaging Het
Olfr365 T A 2: 37,201,994 V251D probably benign Het
Pdgfra T C 5: 75,173,495 S410P probably benign Het
Phldb1 T C 9: 44,715,781 M456V probably damaging Het
Pi16 C T 17: 29,326,896 T216I probably damaging Het
Plekha2 C A 8: 25,059,238 A177S probably benign Het
Prss16 C T 13: 22,003,051 V450I possibly damaging Het
Rab3gap2 T A 1: 185,277,205 L1086H probably damaging Het
Rab3gap2 C T 1: 185,221,899 P56L probably benign Het
Rgs21 A G 1: 144,536,942 V48A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 A G 11: 119,434,686 probably null Het
Slc4a2 G T 5: 24,434,838 V506L probably damaging Het
Sptbn5 C G 2: 120,085,567 probably benign Het
Steap2 C T 5: 5,673,681 V400I probably benign Het
Syne2 G A 12: 75,950,959 G2236D probably benign Het
Tespa1 T C 10: 130,354,755 S84P probably damaging Het
Tlx2 G A 6: 83,069,826 A85V possibly damaging Het
Tm4sf1 A T 3: 57,293,087 F65I probably benign Het
Tmprss13 A G 9: 45,344,955 I456V probably damaging Het
Tpte C T 8: 22,327,748 S250F probably damaging Het
Trim24 T C 6: 37,965,601 F946S probably benign Het
Vmn2r10 A T 5: 108,999,044 Y459* probably null Het
Vps54 T A 11: 21,264,864 I112N probably damaging Het
Vwa1 A G 4: 155,774,465 L13P probably damaging Het
Zfp648 C A 1: 154,204,217 Q41K probably benign Het
Other mutations in Cap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Cap2 APN 13 46639949 splice site probably benign
IGL01927:Cap2 APN 13 46635633 missense probably benign 0.03
IGL02213:Cap2 APN 13 46635611 splice site probably benign
IGL02511:Cap2 APN 13 46531022 start codon destroyed probably null 0.12
IGL02871:Cap2 APN 13 46525492 missense probably benign 0.00
R0063:Cap2 UTSW 13 46638032 splice site probably benign
R0063:Cap2 UTSW 13 46638032 splice site probably benign
R0234:Cap2 UTSW 13 46638022 critical splice donor site probably null
R0234:Cap2 UTSW 13 46638022 critical splice donor site probably null
R0385:Cap2 UTSW 13 46560547 missense probably damaging 1.00
R0387:Cap2 UTSW 13 46560516 missense probably damaging 0.99
R0712:Cap2 UTSW 13 46615361 splice site probably null
R1489:Cap2 UTSW 13 46609635 missense probably damaging 1.00
R1666:Cap2 UTSW 13 46615323 missense probably damaging 0.98
R1668:Cap2 UTSW 13 46615323 missense probably damaging 0.98
R1676:Cap2 UTSW 13 46637859 missense probably damaging 1.00
R1756:Cap2 UTSW 13 46531013 missense probably benign 0.11
R1822:Cap2 UTSW 13 46615347 missense probably benign 0.03
R1867:Cap2 UTSW 13 46640079 missense probably damaging 1.00
R1972:Cap2 UTSW 13 46637899 missense probably damaging 0.98
R1990:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R1991:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R1992:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R2144:Cap2 UTSW 13 46560502 critical splice acceptor site probably null
R3039:Cap2 UTSW 13 46639841 missense probably benign 0.20
R4024:Cap2 UTSW 13 46637841 splice site probably benign
R4554:Cap2 UTSW 13 46635774 missense probably damaging 1.00
R4748:Cap2 UTSW 13 46639826 missense possibly damaging 0.64
R4821:Cap2 UTSW 13 46610110 missense probably damaging 0.99
R4876:Cap2 UTSW 13 46531021 start codon destroyed probably null
R4902:Cap2 UTSW 13 46531025 missense probably damaging 0.99
R5320:Cap2 UTSW 13 46648364 makesense probably null
R5666:Cap2 UTSW 13 46531083 splice site probably null
R6086:Cap2 UTSW 13 46635712 missense probably damaging 1.00
R6728:Cap2 UTSW 13 46639859 missense possibly damaging 0.87
R6842:Cap2 UTSW 13 46646625 missense probably damaging 1.00
R7785:Cap2 UTSW 13 46635748 missense probably benign
R7889:Cap2 UTSW 13 46646575 missense probably damaging 0.99
R8065:Cap2 UTSW 13 46637861 missense probably damaging 1.00
R8205:Cap2 UTSW 13 46615263 missense probably damaging 1.00
R8425:Cap2 UTSW 13 46609732 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCATGTGACCTGTGGCAAG -3'
(R):5'- ACAGCCCTGATTCTAGCACTC -3'

Sequencing Primer
(F):5'- GAGTAACCAAGCCGTTCT -3'
(R):5'- GGTAGTACCTATAATACTGCAGTTGG -3'
Posted On2016-11-09