Incidental Mutation 'R5670:Fer1l6'
ID 442596
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1 like family member 6
Synonyms EG631797
MMRRC Submission 043313-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R5670 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 58381897-58536936 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 58494331 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 1175 (P1175S)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect probably benign
Transcript: ENSMUST00000161028
AA Change: P1175S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: P1175S

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 100,127,068 (GRCm39) probably benign Het
Ahsg T A 16: 22,716,913 (GRCm39) N158K probably benign Het
Arhgef10 T C 8: 15,004,774 (GRCm39) M430T probably benign Het
Becn2 C T 1: 175,749,179 (GRCm39) T415M probably damaging Het
Bmper T A 9: 23,384,759 (GRCm39) M588K probably damaging Het
Btla A T 16: 45,070,782 (GRCm39) D247V probably damaging Het
Cap2 T A 13: 46,684,559 (GRCm39) probably null Het
Chd2 A T 7: 73,091,465 (GRCm39) I1592K probably benign Het
Col4a4 A G 1: 82,463,300 (GRCm39) probably null Het
Copg1 C T 6: 87,889,217 (GRCm39) T853M probably damaging Het
Ddb2 C T 2: 91,042,926 (GRCm39) V353M probably damaging Het
Dip2b A G 15: 100,087,985 (GRCm39) D973G possibly damaging Het
Dscam G A 16: 96,519,364 (GRCm39) T791I probably benign Het
Dtd2 T A 12: 52,046,643 (GRCm39) L65F probably damaging Het
Fzd6 A T 15: 38,894,510 (GRCm39) R225S probably benign Het
Glce A G 9: 61,967,793 (GRCm39) S453P probably damaging Het
Gm4787 G A 12: 81,424,805 (GRCm39) T451I probably benign Het
Igkv8-18 C T 6: 70,333,133 (GRCm39) T25I probably benign Het
Ikzf2 A G 1: 69,617,059 (GRCm39) V96A probably benign Het
Ilkap T C 1: 91,318,863 (GRCm39) T38A probably benign Het
Lpin3 A G 2: 160,739,250 (GRCm39) T353A probably benign Het
Mfsd8 A T 3: 40,776,484 (GRCm39) N389K probably benign Het
Mttp A T 3: 137,830,874 (GRCm39) V65D probably damaging Het
Ndufaf4 A T 4: 24,898,636 (GRCm39) D64V probably damaging Het
Nfe2l2 T C 2: 75,507,462 (GRCm39) T213A probably benign Het
Nkain4 A G 2: 180,584,995 (GRCm39) L73P probably damaging Het
Nwd1 T A 8: 73,419,745 (GRCm39) S977T probably damaging Het
Or1l4 T A 2: 37,092,006 (GRCm39) V251D probably benign Het
Or2y1d T G 11: 49,322,035 (GRCm39) L244R probably damaging Het
Or4b12 T C 2: 90,096,308 (GRCm39) I155M probably benign Het
Or5k1 G A 16: 58,617,424 (GRCm39) P262S possibly damaging Het
Pdgfra T C 5: 75,334,156 (GRCm39) S410P probably benign Het
Phldb1 T C 9: 44,627,078 (GRCm39) M456V probably damaging Het
Pi16 C T 17: 29,545,870 (GRCm39) T216I probably damaging Het
Plekha2 C A 8: 25,549,254 (GRCm39) A177S probably benign Het
Pramel29 A G 4: 143,936,192 (GRCm39) S23P probably benign Het
Prss16 C T 13: 22,187,221 (GRCm39) V450I possibly damaging Het
Rab3gap2 T A 1: 185,009,402 (GRCm39) L1086H probably damaging Het
Rab3gap2 C T 1: 184,954,096 (GRCm39) P56L probably benign Het
Rgs21 A G 1: 144,412,680 (GRCm39) V48A probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rnf213 A G 11: 119,325,512 (GRCm39) probably null Het
Slc4a2 G T 5: 24,639,836 (GRCm39) V506L probably damaging Het
Sptbn5 C G 2: 119,916,048 (GRCm39) probably benign Het
Steap2 C T 5: 5,723,681 (GRCm39) V400I probably benign Het
Syne2 G A 12: 75,997,733 (GRCm39) G2236D probably benign Het
Tespa1 T C 10: 130,190,624 (GRCm39) S84P probably damaging Het
Tlx2 G A 6: 83,046,807 (GRCm39) A85V possibly damaging Het
Tm4sf1 A T 3: 57,200,508 (GRCm39) F65I probably benign Het
Tmprss13 A G 9: 45,256,253 (GRCm39) I456V probably damaging Het
Tpte C T 8: 22,817,764 (GRCm39) S250F probably damaging Het
Trim24 T C 6: 37,942,536 (GRCm39) F946S probably benign Het
Vmn2r10 A T 5: 109,146,910 (GRCm39) Y459* probably null Het
Vps54 T A 11: 21,214,864 (GRCm39) I112N probably damaging Het
Vwa1 A G 4: 155,858,922 (GRCm39) L13P probably damaging Het
Zfp648 C A 1: 154,079,963 (GRCm39) Q41K probably benign Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58,534,636 (GRCm39) missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58,430,251 (GRCm39) missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58,509,763 (GRCm39) splice site probably null
R0304:Fer1l6 UTSW 15 58,462,411 (GRCm39) missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58,420,187 (GRCm39) missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58,509,943 (GRCm39) critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58,430,257 (GRCm39) splice site probably null
R0602:Fer1l6 UTSW 15 58,449,794 (GRCm39) missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58,534,784 (GRCm39) splice site probably null
R0669:Fer1l6 UTSW 15 58,425,573 (GRCm39) splice site probably null
R0854:Fer1l6 UTSW 15 58,431,037 (GRCm39) missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58,435,924 (GRCm39) missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58,474,160 (GRCm39) splice site probably benign
R1483:Fer1l6 UTSW 15 58,509,819 (GRCm39) missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58,513,728 (GRCm39) missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58,518,930 (GRCm39) missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58,429,718 (GRCm39) missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58,497,080 (GRCm39) missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58,474,160 (GRCm39) splice site probably benign
R2041:Fer1l6 UTSW 15 58,430,155 (GRCm39) missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58,499,383 (GRCm39) missense probably benign
R2145:Fer1l6 UTSW 15 58,499,383 (GRCm39) missense probably benign
R2981:Fer1l6 UTSW 15 58,435,926 (GRCm39) missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58,431,087 (GRCm39) missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58,518,998 (GRCm39) missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58,499,371 (GRCm39) missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58,498,129 (GRCm39) critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58,512,075 (GRCm39) missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58,425,554 (GRCm39) missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58,512,060 (GRCm39) missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58,449,798 (GRCm39) missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58,490,751 (GRCm39) missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58,509,869 (GRCm39) missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58,472,160 (GRCm39) critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58,443,250 (GRCm39) missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58,515,769 (GRCm39) missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58,512,003 (GRCm39) missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58,422,126 (GRCm39) missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58,453,752 (GRCm39) nonsense probably null
R5561:Fer1l6 UTSW 15 58,532,674 (GRCm39) missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58,430,175 (GRCm39) missense probably damaging 1.00
R5745:Fer1l6 UTSW 15 58,443,238 (GRCm39) missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58,462,399 (GRCm39) nonsense probably null
R5823:Fer1l6 UTSW 15 58,462,352 (GRCm39) nonsense probably null
R5892:Fer1l6 UTSW 15 58,435,917 (GRCm39) missense probably benign
R6006:Fer1l6 UTSW 15 58,518,893 (GRCm39) missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58,431,055 (GRCm39) missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58,509,806 (GRCm39) missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58,432,488 (GRCm39) missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58,509,855 (GRCm39) missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58,497,026 (GRCm39) nonsense probably null
R6271:Fer1l6 UTSW 15 58,513,767 (GRCm39) missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58,431,081 (GRCm39) nonsense probably null
R6784:Fer1l6 UTSW 15 58,443,275 (GRCm39) missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58,466,727 (GRCm39) missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58,501,227 (GRCm39) missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58,435,899 (GRCm39) missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58,447,146 (GRCm39) missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58,462,384 (GRCm39) missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58,499,446 (GRCm39) missense probably benign
R7463:Fer1l6 UTSW 15 58,445,450 (GRCm39) nonsense probably null
R7464:Fer1l6 UTSW 15 58,445,096 (GRCm39) splice site probably null
R7469:Fer1l6 UTSW 15 58,462,419 (GRCm39) splice site probably null
R7483:Fer1l6 UTSW 15 58,513,794 (GRCm39) missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58,472,281 (GRCm39) missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58,509,875 (GRCm39) missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58,432,331 (GRCm39) missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58,430,245 (GRCm39) missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58,499,438 (GRCm39) missense probably benign
R7607:Fer1l6 UTSW 15 58,534,581 (GRCm39) nonsense probably null
R7677:Fer1l6 UTSW 15 58,474,139 (GRCm39) missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58,502,486 (GRCm39) missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58,432,345 (GRCm39) missense possibly damaging 0.84
R8847:Fer1l6 UTSW 15 58,414,012 (GRCm39) missense possibly damaging 0.72
R9022:Fer1l6 UTSW 15 58,455,329 (GRCm39) missense probably damaging 0.99
R9030:Fer1l6 UTSW 15 58,502,594 (GRCm39) missense probably damaging 1.00
R9160:Fer1l6 UTSW 15 58,515,715 (GRCm39) missense possibly damaging 0.94
R9180:Fer1l6 UTSW 15 58,494,230 (GRCm39) missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58,490,766 (GRCm39) missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58,429,759 (GRCm39) missense possibly damaging 0.88
R9562:Fer1l6 UTSW 15 58,490,370 (GRCm39) missense possibly damaging 0.70
R9682:Fer1l6 UTSW 15 58,422,113 (GRCm39) missense probably benign 0.03
R9775:Fer1l6 UTSW 15 58,497,098 (GRCm39) missense probably benign
X0021:Fer1l6 UTSW 15 58,441,051 (GRCm39) nonsense probably null
X0027:Fer1l6 UTSW 15 58,501,189 (GRCm39) missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58,490,423 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCAGCAACAGAGTCTTC -3'
(R):5'- GAAGAAACCCTTGCCTTCCC -3'

Sequencing Primer
(F):5'- AGAGTCTTCCAACCTCCTCAG -3'
(R):5'- GCCTTCCCAAGCTAATGAATTTGG -3'
Posted On 2016-11-09