Incidental Mutation 'R5670:Dip2b'
ID 442597
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 043313-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.615) question?
Stock # R5670 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100087985 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 973 (D973G)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
AlphaFold Q3UH60
Predicted Effect probably benign
Transcript: ENSMUST00000023768
AA Change: D739G

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: D739G

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100203
AA Change: D973G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: D973G

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108971
AA Change: D739G

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: D739G

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229080
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 100,127,068 (GRCm39) probably benign Het
Ahsg T A 16: 22,716,913 (GRCm39) N158K probably benign Het
Arhgef10 T C 8: 15,004,774 (GRCm39) M430T probably benign Het
Becn2 C T 1: 175,749,179 (GRCm39) T415M probably damaging Het
Bmper T A 9: 23,384,759 (GRCm39) M588K probably damaging Het
Btla A T 16: 45,070,782 (GRCm39) D247V probably damaging Het
Cap2 T A 13: 46,684,559 (GRCm39) probably null Het
Chd2 A T 7: 73,091,465 (GRCm39) I1592K probably benign Het
Col4a4 A G 1: 82,463,300 (GRCm39) probably null Het
Copg1 C T 6: 87,889,217 (GRCm39) T853M probably damaging Het
Ddb2 C T 2: 91,042,926 (GRCm39) V353M probably damaging Het
Dscam G A 16: 96,519,364 (GRCm39) T791I probably benign Het
Dtd2 T A 12: 52,046,643 (GRCm39) L65F probably damaging Het
Fer1l6 C T 15: 58,494,331 (GRCm39) P1175S probably benign Het
Fzd6 A T 15: 38,894,510 (GRCm39) R225S probably benign Het
Glce A G 9: 61,967,793 (GRCm39) S453P probably damaging Het
Gm4787 G A 12: 81,424,805 (GRCm39) T451I probably benign Het
Igkv8-18 C T 6: 70,333,133 (GRCm39) T25I probably benign Het
Ikzf2 A G 1: 69,617,059 (GRCm39) V96A probably benign Het
Ilkap T C 1: 91,318,863 (GRCm39) T38A probably benign Het
Lpin3 A G 2: 160,739,250 (GRCm39) T353A probably benign Het
Mfsd8 A T 3: 40,776,484 (GRCm39) N389K probably benign Het
Mttp A T 3: 137,830,874 (GRCm39) V65D probably damaging Het
Ndufaf4 A T 4: 24,898,636 (GRCm39) D64V probably damaging Het
Nfe2l2 T C 2: 75,507,462 (GRCm39) T213A probably benign Het
Nkain4 A G 2: 180,584,995 (GRCm39) L73P probably damaging Het
Nwd1 T A 8: 73,419,745 (GRCm39) S977T probably damaging Het
Or1l4 T A 2: 37,092,006 (GRCm39) V251D probably benign Het
Or2y1d T G 11: 49,322,035 (GRCm39) L244R probably damaging Het
Or4b12 T C 2: 90,096,308 (GRCm39) I155M probably benign Het
Or5k1 G A 16: 58,617,424 (GRCm39) P262S possibly damaging Het
Pdgfra T C 5: 75,334,156 (GRCm39) S410P probably benign Het
Phldb1 T C 9: 44,627,078 (GRCm39) M456V probably damaging Het
Pi16 C T 17: 29,545,870 (GRCm39) T216I probably damaging Het
Plekha2 C A 8: 25,549,254 (GRCm39) A177S probably benign Het
Pramel29 A G 4: 143,936,192 (GRCm39) S23P probably benign Het
Prss16 C T 13: 22,187,221 (GRCm39) V450I possibly damaging Het
Rab3gap2 T A 1: 185,009,402 (GRCm39) L1086H probably damaging Het
Rab3gap2 C T 1: 184,954,096 (GRCm39) P56L probably benign Het
Rgs21 A G 1: 144,412,680 (GRCm39) V48A probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rnf213 A G 11: 119,325,512 (GRCm39) probably null Het
Slc4a2 G T 5: 24,639,836 (GRCm39) V506L probably damaging Het
Sptbn5 C G 2: 119,916,048 (GRCm39) probably benign Het
Steap2 C T 5: 5,723,681 (GRCm39) V400I probably benign Het
Syne2 G A 12: 75,997,733 (GRCm39) G2236D probably benign Het
Tespa1 T C 10: 130,190,624 (GRCm39) S84P probably damaging Het
Tlx2 G A 6: 83,046,807 (GRCm39) A85V possibly damaging Het
Tm4sf1 A T 3: 57,200,508 (GRCm39) F65I probably benign Het
Tmprss13 A G 9: 45,256,253 (GRCm39) I456V probably damaging Het
Tpte C T 8: 22,817,764 (GRCm39) S250F probably damaging Het
Trim24 T C 6: 37,942,536 (GRCm39) F946S probably benign Het
Vmn2r10 A T 5: 109,146,910 (GRCm39) Y459* probably null Het
Vps54 T A 11: 21,214,864 (GRCm39) I112N probably damaging Het
Vwa1 A G 4: 155,858,922 (GRCm39) L13P probably damaging Het
Zfp648 C A 1: 154,079,963 (GRCm39) Q41K probably benign Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACAGTGTGTACATATTGGTACC -3'
(R):5'- CACTGCAAAATCTCTGCCAGG -3'

Sequencing Primer
(F):5'- CTTGGCCATTGCTGAATGAAC -3'
(R):5'- GAACTGGTGCTAAAATCACAACG -3'
Posted On 2016-11-09