Incidental Mutation 'R5671:Pcsk1'
ID 442636
Institutional Source Beutler Lab
Gene Symbol Pcsk1
Ensembl Gene ENSMUSG00000021587
Gene Name proprotein convertase subtilisin/kexin type 1
Synonyms PC3, PC1, Nec-1, SPC3, prohormone convertase 1/3, Nec1, Phpp-1
MMRRC Submission 043314-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5671 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 75089826-75134861 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75097907 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 135 (T135A)
Ref Sequence ENSEMBL: ENSMUSP00000022075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022075]
AlphaFold P63239
PDB Structure Solution Structure of the Mouse Prohormone Convertase 1 Pro-Domain [SOLUTION NMR]
PC1/3 DCSG sorting domain structure in DPC [SOLUTION NMR]
PC1/3 DCSG sorting domain in CHAPS [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022075
AA Change: T135A

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022075
Gene: ENSMUSG00000021587
AA Change: T135A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:S8_pro-domain 34 110 6.4e-26 PFAM
Pfam:Peptidase_S8 158 442 2.2e-49 PFAM
Pfam:P_proprotein 504 591 6.1e-30 PFAM
low complexity region 679 694 N/A INTRINSIC
Pfam:Proho_convert 713 751 4.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135349
Meta Mutation Damage Score 0.0947 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. The protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Mutations in this gene have been associated with susceptibility to obesity and proprotein convertase 1/3 deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show pre- and postnatal death, low weight, diarrhea, hypoglycemia, low insulin and GHRH levels, and lack mature glucagon and ACTH levels. Homozygotes for another null allele die prior to implantation. ENU mutants show obesity, polyphagia and higher metabolic efficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930444G20Rik T A 10: 22,066,843 T413S possibly damaging Het
A530099J19Rik A G 13: 19,729,295 noncoding transcript Het
Ak2 T A 4: 129,008,247 F238I probably damaging Het
Akap8l T C 17: 32,338,292 Y115C probably damaging Het
Alms1 T A 6: 85,629,208 N2613K possibly damaging Het
Antxr1 C T 6: 87,217,273 probably null Het
Ap3b1 A T 13: 94,528,257 R901S unknown Het
Arhgap45 A G 10: 80,025,476 E491G probably damaging Het
Capn11 C T 17: 45,639,674 R293Q possibly damaging Het
Cdx1 C T 18: 61,019,899 V212I probably benign Het
Clca4b G A 3: 144,921,863 T449I probably benign Het
Clec14a T C 12: 58,267,826 I337V probably benign Het
Clip4 A C 17: 71,789,883 M1L probably damaging Het
Exoc3l4 T C 12: 111,423,417 I142T probably damaging Het
Flnb T A 14: 7,890,843 I575N probably benign Het
Gad1-ps A T 10: 99,444,533 noncoding transcript Het
Golga7 C T 8: 23,250,344 A57T probably damaging Het
Gpa33 A G 1: 166,146,791 T66A possibly damaging Het
Gpr45 A G 1: 43,033,058 Y287C probably damaging Het
H2-Eb1 C A 17: 34,314,255 Y150* probably null Het
H2-Ke6 T C 17: 34,026,461 D233G probably null Het
Ifna6 A T 4: 88,827,669 Q85L probably damaging Het
Igkv9-120 G A 6: 68,050,273 W57* probably null Het
Ivns1abp G T 1: 151,354,009 L149F probably benign Het
Kank4 A G 4: 98,765,461 probably null Het
Lama2 A T 10: 27,190,544 C1114S probably damaging Het
Lmbr1l A C 15: 98,907,608 D337E possibly damaging Het
Ly75 T C 2: 60,308,311 D1404G probably damaging Het
Muc4 A G 16: 32,753,720 T1199A probably benign Het
Nalcn A G 14: 123,295,406 I1314T probably damaging Het
Nhlrc1 A G 13: 47,013,717 F355L probably benign Het
Olfr1285 C T 2: 111,408,473 noncoding transcript Het
Olfr1388 T C 11: 49,444,313 V154A probably benign Het
Olfr1444 A T 19: 12,861,807 T11S probably benign Het
Ptpru T A 4: 131,820,190 Y112F possibly damaging Het
Rbbp8 A G 18: 11,742,642 S871G probably benign Het
Rhoj A T 12: 75,393,969 I135F probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ska1 G T 18: 74,196,996 D224E probably damaging Het
Slc11a2 A G 15: 100,403,288 Y295H probably damaging Het
Slc22a28 A T 19: 8,131,431 C116S probably damaging Het
Synpo T C 18: 60,595,950 D1060G probably damaging Het
Tectb T C 19: 55,192,627 S310P probably benign Het
Tmc6 A G 11: 117,775,615 S288P possibly damaging Het
Tpo A G 12: 30,119,491 S82P probably benign Het
Ttyh3 T A 5: 140,631,552 M321L probably benign Het
Usp8 A G 2: 126,742,425 D518G probably benign Het
Vmn2r11 A G 5: 109,054,906 W102R probably benign Het
Vps13a G A 19: 16,715,100 H817Y probably benign Het
Vps51 A G 19: 6,068,194 V757A probably benign Het
Washc4 T C 10: 83,570,028 S463P probably damaging Het
Zfp423 T C 8: 87,782,327 N442S probably damaging Het
Other mutations in Pcsk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pcsk1 APN 13 75132087 missense probably benign
IGL01554:Pcsk1 APN 13 75132307 missense probably benign
IGL01960:Pcsk1 APN 13 75093167 missense possibly damaging 0.82
IGL02026:Pcsk1 APN 13 75112653 missense probably benign 0.16
IGL02047:Pcsk1 APN 13 75097989 missense probably benign 0.33
IGL02264:Pcsk1 APN 13 75105959 missense probably damaging 1.00
IGL02441:Pcsk1 APN 13 75132163 missense probably benign 0.16
IGL02795:Pcsk1 APN 13 75112620 missense probably damaging 1.00
IGL02829:Pcsk1 APN 13 75126836 missense probably damaging 1.00
IGL03116:Pcsk1 APN 13 75132216 missense probably damaging 0.99
IGL03156:Pcsk1 APN 13 75131951 missense probably benign
clipper UTSW 13 75130070 missense probably damaging 1.00
spareribs UTSW 13 75115255 missense possibly damaging 0.88
swivel UTSW 13 75125984 missense probably damaging 1.00
Tweeze UTSW 13 75126839 missense probably benign 0.00
PIT4453001:Pcsk1 UTSW 13 75112650 missense probably damaging 1.00
R0771:Pcsk1 UTSW 13 75132162 missense probably benign 0.31
R0894:Pcsk1 UTSW 13 75097977 missense probably damaging 1.00
R1014:Pcsk1 UTSW 13 75132234 missense probably damaging 1.00
R1035:Pcsk1 UTSW 13 75132119 missense probably benign
R1199:Pcsk1 UTSW 13 75096413 splice site probably benign
R1517:Pcsk1 UTSW 13 75098047 nonsense probably null
R1625:Pcsk1 UTSW 13 75126852 missense probably benign 0.11
R1691:Pcsk1 UTSW 13 75132225 missense possibly damaging 0.65
R1717:Pcsk1 UTSW 13 75110828 missense probably damaging 0.99
R2168:Pcsk1 UTSW 13 75112534 intron probably benign
R2252:Pcsk1 UTSW 13 75126726 missense probably benign 0.00
R2400:Pcsk1 UTSW 13 75090126 missense probably benign 0.00
R4110:Pcsk1 UTSW 13 75096369 missense probably damaging 0.99
R4358:Pcsk1 UTSW 13 75112719 missense possibly damaging 0.58
R4359:Pcsk1 UTSW 13 75112719 missense possibly damaging 0.58
R4657:Pcsk1 UTSW 13 75132235 missense probably damaging 1.00
R5195:Pcsk1 UTSW 13 75126855 missense probably damaging 1.00
R5669:Pcsk1 UTSW 13 75130102 missense probably benign 0.01
R5745:Pcsk1 UTSW 13 75131960 missense probably benign 0.03
R6107:Pcsk1 UTSW 13 75127848 missense probably benign 0.09
R6200:Pcsk1 UTSW 13 75115255 missense possibly damaging 0.88
R6326:Pcsk1 UTSW 13 75132179 missense possibly damaging 0.89
R6537:Pcsk1 UTSW 13 75132239 missense probably damaging 1.00
R6541:Pcsk1 UTSW 13 75125984 missense probably damaging 1.00
R6567:Pcsk1 UTSW 13 75130070 missense probably damaging 1.00
R6723:Pcsk1 UTSW 13 75093069 splice site probably null
R7258:Pcsk1 UTSW 13 75093186 missense probably damaging 1.00
R7357:Pcsk1 UTSW 13 75125960 missense probably damaging 0.96
R7487:Pcsk1 UTSW 13 75110883 missense probably benign 0.01
R7519:Pcsk1 UTSW 13 75110865 missense probably damaging 0.99
R7647:Pcsk1 UTSW 13 75132210 missense possibly damaging 0.73
R7787:Pcsk1 UTSW 13 75132158 missense possibly damaging 0.88
R7944:Pcsk1 UTSW 13 75132092 missense probably benign
R7945:Pcsk1 UTSW 13 75132092 missense probably benign
R7961:Pcsk1 UTSW 13 75126839 missense probably benign 0.00
R8009:Pcsk1 UTSW 13 75126839 missense probably benign 0.00
R8022:Pcsk1 UTSW 13 75099293 missense possibly damaging 0.77
R8171:Pcsk1 UTSW 13 75090091 nonsense probably null
R8489:Pcsk1 UTSW 13 75126002 missense probably damaging 1.00
R9310:Pcsk1 UTSW 13 75090072 missense probably benign
R9404:Pcsk1 UTSW 13 75132223 missense probably benign 0.11
R9544:Pcsk1 UTSW 13 75110920 missense probably damaging 0.99
R9588:Pcsk1 UTSW 13 75110920 missense probably damaging 0.99
R9706:Pcsk1 UTSW 13 75099354 critical splice donor site probably null
Z1176:Pcsk1 UTSW 13 75098042 missense probably damaging 1.00
Z1177:Pcsk1 UTSW 13 75125864 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGAACGCTTGAGCTTGC -3'
(R):5'- ATGACTCCCTAAGTGACAGAAATAG -3'

Sequencing Primer
(F):5'- GGAACGCTTGAGCTTGCTAATAC -3'
(R):5'- GGATAGTTCAGACTCACATAATTGGC -3'
Posted On 2016-11-09